pycom09g18730

May regulate transcription elongation by RNA polymerase II. May enhance transcriptional pausing at sites proximal to the promoter, which may in turn facilitate the assembly of an elongation competent RNA polymerase II complex

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr9
N/A
Physical Location & Seq
Reverse (-)
19510333 .. 19510880
548 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 231 bp
ATGAGGAACGCCCAATCGGAACCAGCCCAGATTCCGACGAGCTTCGGCCACGAGCTTAGGGCTTGCCTCCGTTGCCGCCTCGTTAAGACCTACGATCAGGTTAGGGATCGATCTCGTCTAGTAATGGATCCGAGTAGGAGTTGGGCTGCGCGGTGGCTCCGAATTGGTATGTATTGGTTCATACAAATTTTGTGTATTCCAAGATTTTTCTTTGACAGAATGATGCATTGA

Protein Analysis

77

Amino Acids

9.26

Weight (kDa)

10.69

Isoelectric Point (pI)

77.23

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccII CGCG 1 cut(s) 151
AciI CCGC 2 cut(s) 76, 151
AclWI GGATC 3 cut(s) 114, 122, 135
AcoI YGGCCR 1 cut(s) 46
AcsI RAATTY 1 cut(s) 186
AluBI AGCT 2 cut(s) 42, 55
AluI AGCT 2 cut(s) 42, 55
AlwI GGATC 3 cut(s) 114, 122, 135
AoxI GGCC 1 cut(s) 46
ApeKI GCWGC 1 cut(s) 146
ApoI RAATTY 1 cut(s) 186
AspLEI GCGC 1 cut(s) 151
BamHI GGATCC 1 cut(s) 127
BauI CACGAG 1 cut(s) 50
BbvI GCAGC 1 cut(s) 133
BfaI CTAG 1 cut(s) 119
BisI GCNGC 2 cut(s) 76, 147
BlsI GCNGC 2 cut(s) 77, 148
BmiI GGNNCC 3 cut(s) 21, 129, 158
BmsI GCATC 1 cut(s) 213
Bpu10I CCTNAGC 1 cut(s) 56
Bsa29I ATCGAT 1 cut(s) 109
BseCI ATCGAT 1 cut(s) 109
BseXI GCAGC 1 cut(s) 133
Bsh1236I CGCG 1 cut(s) 151
BshFI GGCC 1 cut(s) 48
BshVI ATCGAT 1 cut(s) 109
BsnI GGCC 1 cut(s) 48
Bsp143I GATC 4 cut(s) 94, 106, 110, 127
BspACI CCGC 2 cut(s) 76, 151
BspANI GGCC 1 cut(s) 48
BspDI ATCGAT 1 cut(s) 109
BspFNI CGCG 1 cut(s) 151
BspLI GGNNCC 3 cut(s) 21, 129, 158
BspPI GGATC 3 cut(s) 114, 122, 135
BssMI GATC 4 cut(s) 94, 106, 110, 127
BssSI CACGAG 1 cut(s) 50
Bst2BI CACGAG 1 cut(s) 50
BstC8I GCNNGC 1 cut(s) 64
BstDEI CTNAG 1 cut(s) 56
BstFNI CGCG 1 cut(s) 151
BstHHI GCGC 1 cut(s) 151
BstKTI GATC 4 cut(s) 97, 109, 113, 130
BstMBI GATC 4 cut(s) 94, 106, 110, 127
BstMWI GCNNNNNNNGC 1 cut(s) 72
BstUI CGCG 1 cut(s) 151
BstV1I GCAGC 1 cut(s) 133
BstX2I RGATCY 1 cut(s) 127
BstYI RGATCY 1 cut(s) 127
Bsu15I ATCGAT 1 cut(s) 109
BsuRI GGCC 1 cut(s) 48
BsuTUI ATCGAT 1 cut(s) 109
Cac8I GCNNGC 1 cut(s) 64
CfoI GCGC 1 cut(s) 151
ClaI ATCGAT 1 cut(s) 109
CviJI RGCY 7 cut(s) 26, 42, 48, 55, 62, 146, 157
CviKI_1 RGCY 7 cut(s) 26, 42, 48, 55, 62, 146, 157
DdeI CTNAG 1 cut(s) 56
DpnI GATC 4 cut(s) 96, 108, 112, 129
DpnII GATC 4 cut(s) 94, 106, 110, 127
EaeI YGGCCR 1 cut(s) 46
EcoT22I ATGCAT 1 cut(s) 228
FaiI YATR 2 cut(s) 170, 182
Fnu4HI GCNGC 2 cut(s) 76, 147
Fsp4HI GCNGC 2 cut(s) 76, 147
FspBI CTAG 1 cut(s) 119
GlaI GCGC 1 cut(s) 150
GluI GCNGC 2 cut(s) 76, 147
HaeIII GGCC 1 cut(s) 48
HhaI GCGC 1 cut(s) 151
Hin6I GCGC 1 cut(s) 149
HinP1I GCGC 1 cut(s) 149
HinfI GANTC 1 cut(s) 31
Hpy188I TCNGA 4 cut(s) 19, 36, 132, 161
Hpy99I CGWCG 1 cut(s) 40
HpyCH4V TGCA 1 cut(s) 226
HpyF10VI GCNNNNNNNGC 1 cut(s) 72
HpyF3I CTNAG 1 cut(s) 56
HspAI GCGC 1 cut(s) 149
Kzo9I GATC 4 cut(s) 94, 106, 110, 127
LmnI GCTCC 1 cut(s) 162
LpnPI CCDG 3 cut(s) 36, 41, 83
Lsp1109I GCAGC 1 cut(s) 133
LweI GCATC 1 cut(s) 213
MaeI CTAG 1 cut(s) 119
MalI GATC 4 cut(s) 96, 108, 112, 129
MboI GATC 4 cut(s) 94, 106, 110, 127
MflI RGATCY 1 cut(s) 127
MluCI AATT 2 cut(s) 162, 186
MmeI TCCRAC 1 cut(s) 59
MnlI CCTC 2 cut(s) 77, 89
Mph1103I ATGCAT 1 cut(s) 228
MseI TTAA 1 cut(s) 84
MvnI CGCG 1 cut(s) 151
MwoI GCNNNNNNNGC 1 cut(s) 72
NdeII GATC 4 cut(s) 94, 106, 110, 127
NlaIV GGNNCC 3 cut(s) 21, 129, 158
NsiI ATGCAT 1 cut(s) 228
PfeI GAWTC 1 cut(s) 31
PkrI GCNGC 2 cut(s) 77, 148
PspN4I GGNNCC 3 cut(s) 21, 129, 158
PsuI RGATCY 1 cut(s) 127
SaqAI TTAA 1 cut(s) 84
SatI GCNGC 2 cut(s) 76, 147
Sau3AI GATC 4 cut(s) 94, 106, 110, 127
SetI ASST 4 cut(s) 44, 57, 92, 102
SfaNI GCATC 1 cut(s) 213
Sse9I AATT 2 cut(s) 162, 186
SsiI CCGC 2 cut(s) 76, 151
SspMI CTAG 1 cut(s) 119
TaqI TCGA 1 cut(s) 109
TasI AATT 2 cut(s) 162, 186
TauI GCSGC 1 cut(s) 78
TfiI GAWTC 1 cut(s) 31
Tru1I TTAA 1 cut(s) 84
Tru9I TTAA 1 cut(s) 84
TseI GCWGC 1 cut(s) 146
TspDTI ATGAA 1 cut(s) 169
TspGWI ACGGA 1 cut(s) 59
XapI RAATTY 1 cut(s) 186
XspI CTAG 1 cut(s) 119
Zsp2I ATGCAT 1 cut(s) 228
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.