pycom1094g00060

Acyl-protein thioesterase

Basic Information

Type: gene
Biological Identity
pyrus_communis
tig00001094
N/A
Physical Location & Seq
Forward (+)
136259 .. 137561
1303 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 186 bp
ATGAGCTATGCGCATTCTAACATGTCTTCTGGTAGCAGAACTGCTAAGAGAATTGAGTTTGGTAGGACACATGTGGTGAGGCCCAAAGGAAAGCATCAAGCAACAATGGTCTGGCTGCATGGACTTGGAGATAACGGCTCAAGTCTGGACTTTTTACCACACTTGTGCTTTCGTTGCTTGTGTTGA

Protein Analysis

62

Amino Acids

6.83

Weight (kDa)

9.75

Isoelectric Point (pI)

52.06

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc16I TGCGCA 1 cut(s) 12
AflIII ACRYGT 2 cut(s) 21, 70
AleI CACNNNNGTG 1 cut(s) 163
AluBI AGCT 1 cut(s) 6
AluI AGCT 1 cut(s) 6
AoxI GGCC 1 cut(s) 80
ApeKI GCWGC 1 cut(s) 115
AspLEI GCGC 1 cut(s) 13
AspS9I GGNCC 1 cut(s) 81
AsuHPI GGTGA 1 cut(s) 88
BbsI GAAGAC 1 cut(s) 18
BbvI GCAGC 1 cut(s) 102
BceAI ACGGC 1 cut(s) 151
BisI GCNGC 1 cut(s) 116
BlsI GCNGC 1 cut(s) 117
BmgT120I GGNCC 1 cut(s) 81
BmsI GCATC 1 cut(s) 103
BpiI GAAGAC 1 cut(s) 18
BpuEI CTTGAG 1 cut(s) 124
BseXI GCAGC 1 cut(s) 102
BshFI GGCC 1 cut(s) 82
BsmI GAATGC 1 cut(s) 13
BsnI GGCC 1 cut(s) 82
BspANI GGCC 1 cut(s) 82
BstDEI CTNAG 1 cut(s) 45
BstHHI GCGC 1 cut(s) 13
BstMWI GCNNNNNNNGC 1 cut(s) 174
BstNSI RCATGY 2 cut(s) 25, 74
BstV1I GCAGC 1 cut(s) 102
BstV2I GAAGAC 1 cut(s) 18
BsuRI GGCC 1 cut(s) 82
CfoI GCGC 1 cut(s) 13
Cfr13I GGNCC 1 cut(s) 81
CviAII CATG 3 cut(s) 22, 71, 119
CviJI RGCY 4 cut(s) 6, 82, 115, 138
CviKI_1 RGCY 4 cut(s) 6, 82, 115, 138
DdeI CTNAG 1 cut(s) 45
FaeI CATG 3 cut(s) 25, 74, 122
FaiI YATR 4 cut(s) 9, 23, 72, 120
FatI CATG 3 cut(s) 21, 70, 118
Fnu4HI GCNGC 1 cut(s) 116
Fsp4HI GCNGC 1 cut(s) 116
FspAI RTGCGCAY 1 cut(s) 12
FspI TGCGCA 1 cut(s) 12
GlaI GCGC 1 cut(s) 12
GluI GCNGC 1 cut(s) 116
HaeIII GGCC 1 cut(s) 82
HhaI GCGC 1 cut(s) 13
Hin1II CATG 3 cut(s) 25, 74, 122
Hin6I GCGC 1 cut(s) 11
HinP1I GCGC 1 cut(s) 11
HphI GGTGA 1 cut(s) 88
Hpy188III TCNNGA 1 cut(s) 146
HpyCH4V TGCA 1 cut(s) 118
HpyF10VI GCNNNNNNNGC 1 cut(s) 174
HpyF3I CTNAG 1 cut(s) 45
Hsp92II CATG 3 cut(s) 25, 74, 122
HspAI GCGC 1 cut(s) 11
LpnPI CCDG 3 cut(s) 15, 97, 131
Lsp1109I GCAGC 1 cut(s) 102
LweI GCATC 1 cut(s) 103
MboII GAAGA 1 cut(s) 18
MluCI AATT 1 cut(s) 51
MnlI CCTC 1 cut(s) 72
MslI CAYNNNNRTG 1 cut(s) 163
Mva1269I GAATGC 1 cut(s) 13
MwoI GCNNNNNNNGC 1 cut(s) 174
NlaIII CATG 3 cut(s) 25, 74, 122
NsbI TGCGCA 1 cut(s) 12
NspI RCATGY 2 cut(s) 25, 74
OliI CACNNNNGTG 1 cut(s) 163
PciI ACATGT 2 cut(s) 21, 70
PctI GAATGC 1 cut(s) 13
PkrI GCNGC 1 cut(s) 117
PscI ACATGT 2 cut(s) 21, 70
PspPI GGNCC 1 cut(s) 81
RseI CAYNNNNRTG 1 cut(s) 163
SatI GCNGC 1 cut(s) 116
Sau96I GGNCC 1 cut(s) 81
SetI ASST 1 cut(s) 8
SfaNI GCATC 1 cut(s) 103
SmiMI CAYNNNNRTG 1 cut(s) 163
SmlI CTYRAG 1 cut(s) 139
SmoI CTYRAG 1 cut(s) 139
Sse9I AATT 1 cut(s) 51
TasI AATT 1 cut(s) 51
TseI GCWGC 1 cut(s) 115
XceI RCATGY 2 cut(s) 25, 74
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.