pycom10g00340

Acts as a sulfur carrier required for molybdopterin biosynthesis. Component of the molybdopterin synthase complex that catalyzes the conversion of precursor Z into molybdopterin by mediating the incorporation of 2 sulfur atoms into precursor Z to generate a dithiolene group. In the complex, serves as sulfur donor by being thiocarboxylated (-COSH) at its C-terminus by MOCS3. After interaction with MOCS2B, the sulfur is then transferred to precursor Z to form molybdopterin

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr10
N/A
Physical Location & Seq
Forward (+)
412786 .. 413082
297 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 297 bp
ATGGATTCCAAACAAGAAGAGATGAAGACGGCAACCACAGACTCTACAAGTAAAGGGATCGGGGGTTCATCTGTTAATATAAAGGTGCTGTTCTTTGCCAGGGCTCGTGACCTAACTGGCTTGAGTGATACACAACTGGAGGTGTCGTCTGGTAGTACTGCACTTGATTGTTTAGATAAGCTCATCACCATGTTTCCAAACTTGTCAGATCGATCCGTGGGTGCATGGTGCTTGCTCTTAATGAGGCGTACACGGCTGATTCTGCTGTCGTTAAAGACAAGGATGAGTTGGCCATAA

Protein Analysis

99

Amino Acids

10.82

Weight (kDa)

9.18

Isoelectric Point (pI)

41.37

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 2 cut(s) 65, 207
AcoI YGGCCR 1 cut(s) 290
AfaI GTAC 2 cut(s) 157, 250
AjnI CCWGG 1 cut(s) 98
AloI GAACNNNNNNTCC 2 cut(s) 49, 81
AluBI AGCT 1 cut(s) 181
AluI AGCT 1 cut(s) 181
AlwI GGATC 2 cut(s) 65, 207
AoxI GGCC 1 cut(s) 290
AsuHPI GGTGA 1 cut(s) 178
BalI TGGCCA 1 cut(s) 292
BanII GRGCYC 1 cut(s) 106
BauI CACGAG 1 cut(s) 105
BbsI GAAGAC 1 cut(s) 32
BceAI ACGGC 2 cut(s) 45, 269
BciT130I CCWGG 1 cut(s) 100
BmcAI AGTACT 1 cut(s) 157
Bme1390I CCNGG 1 cut(s) 100
BmrFI CCNGG 1 cut(s) 100
BpiI GAAGAC 1 cut(s) 32
BpmI CTGGAG 1 cut(s) 158
BpuEI CTTGAG 1 cut(s) 142
Bsa29I ATCGAT 1 cut(s) 211
BsaJI CCNNGG 2 cut(s) 99, 216
BsaXI ACNNNNNCTCC 2 cut(s) 131, 161
Bse1I ACTGG 2 cut(s) 121, 141
BseBI CCWGG 1 cut(s) 100
BseCI ATCGAT 1 cut(s) 211
BseDI CCNNGG 2 cut(s) 99, 216
BseGI GGATG 1 cut(s) 288
BseNI ACTGG 2 cut(s) 121, 141
BsgI GTGCAG 1 cut(s) 144
BshFI GGCC 1 cut(s) 292
BshVI ATCGAT 1 cut(s) 211
BsnI GGCC 1 cut(s) 292
Bsp1286I GDGCHC 1 cut(s) 106
Bsp143I GATC 3 cut(s) 57, 208, 212
BspANI GGCC 1 cut(s) 292
BspDI ATCGAT 1 cut(s) 211
BspPI GGATC 2 cut(s) 65, 207
BsrI ACTGG 2 cut(s) 121, 141
BssECI CCNNGG 2 cut(s) 99, 216
BssMI GATC 3 cut(s) 57, 208, 212
BssSI CACGAG 1 cut(s) 105
Bst2BI CACGAG 1 cut(s) 105
Bst2UI CCWGG 1 cut(s) 100
Bst6I CTCTTC 1 cut(s) 12
BstC8I GCNNGC 1 cut(s) 233
BstDSI CCRYGG 1 cut(s) 216
BstF5I GGATG 1 cut(s) 288
BstKTI GATC 3 cut(s) 60, 211, 215
BstMBI GATC 3 cut(s) 57, 208, 212
BstMWI GCNNNNNNNGC 2 cut(s) 253, 262
BstNI CCWGG 1 cut(s) 100
BstSCI CCNGG 1 cut(s) 98
BstV2I GAAGAC 1 cut(s) 32
Bsu15I ATCGAT 1 cut(s) 211
BsuRI GGCC 1 cut(s) 292
BsuTUI ATCGAT 1 cut(s) 211
BtgI CCRYGG 1 cut(s) 216
BtsCI GGATG 1 cut(s) 288
Cac8I GCNNGC 1 cut(s) 233
ClaI ATCGAT 1 cut(s) 211
Csp6I GTAC 2 cut(s) 156, 249
CviAII CATG 2 cut(s) 190, 225
CviJI RGCY 5 cut(s) 104, 120, 181, 256, 292
CviKI_1 RGCY 5 cut(s) 104, 120, 181, 256, 292
CviQI GTAC 2 cut(s) 156, 249
DpnI GATC 3 cut(s) 59, 210, 214
DpnII GATC 3 cut(s) 57, 208, 212
EaeI YGGCCR 1 cut(s) 290
Eam1104I CTCTTC 1 cut(s) 12
EarI CTCTTC 1 cut(s) 12
Eco24I GRGCYC 1 cut(s) 106
EcoRII CCWGG 1 cut(s) 98
EcoT38I GRGCYC 1 cut(s) 106
FaeI CATG 2 cut(s) 193, 228
FaiI YATR 4 cut(s) 80, 191, 226, 295
FatI CATG 2 cut(s) 189, 224
FriOI GRGCYC 1 cut(s) 106
GsuI CTGGAG 1 cut(s) 158
HaeIII GGCC 1 cut(s) 292
Hin1II CATG 2 cut(s) 193, 228
HinfI GANTC 3 cut(s) 5, 41, 259
HphI GGTGA 1 cut(s) 178
Hpy166II GTNNAC 1 cut(s) 251
Hpy188I TCNGA 1 cut(s) 208
Hpy188III TCNNGA 1 cut(s) 107
Hpy8I GTNNAC 1 cut(s) 251
HpyCH4V TGCA 2 cut(s) 161, 224
HpyF10VI GCNNNNNNNGC 2 cut(s) 253, 262
Hsp92II CATG 2 cut(s) 193, 228
Kzo9I GATC 3 cut(s) 57, 208, 212
LpnPI CCDG 5 cut(s) 85, 102, 112, 122, 135
MaeIII GTNAC 1 cut(s) 107
MalI GATC 3 cut(s) 59, 210, 214
MboI GATC 3 cut(s) 57, 208, 212
MboII GAAGA 2 cut(s) 29, 37
MhlI GDGCHC 1 cut(s) 106
MlsI TGGCCA 1 cut(s) 292
MluNI TGGCCA 1 cut(s) 292
MlyI GAGTC 1 cut(s) 35
MnlI CCTC 2 cut(s) 133, 237
Mox20I TGGCCA 1 cut(s) 292
MscI TGGCCA 1 cut(s) 292
MseI TTAA 3 cut(s) 75, 239, 272
MslI CAYNNNNRTG 1 cut(s) 188
Msp20I TGGCCA 1 cut(s) 292
MspR9I CCNGG 1 cut(s) 100
MvaI CCWGG 1 cut(s) 100
MwoI GCNNNNNNNGC 2 cut(s) 253, 262
NdeII GATC 3 cut(s) 57, 208, 212
NlaIII CATG 2 cut(s) 193, 228
NmuCI GTSAC 1 cut(s) 107
PfeI GAWTC 2 cut(s) 5, 259
PleI GAGTC 1 cut(s) 35
PpsI GAGTC 1 cut(s) 35
Psp6I CCWGG 1 cut(s) 98
PspGI CCWGG 1 cut(s) 98
RsaI GTAC 2 cut(s) 157, 250
RsaNI GTAC 2 cut(s) 156, 249
RseI CAYNNNNRTG 1 cut(s) 188
SaqAI TTAA 3 cut(s) 75, 239, 272
Sau3AI GATC 3 cut(s) 57, 208, 212
ScaI AGTACT 1 cut(s) 157
SchI GAGTC 1 cut(s) 35
ScrFI CCNGG 1 cut(s) 100
SduI GDGCHC 1 cut(s) 106
SetI ASST 4 cut(s) 87, 114, 144, 183
SmiMI CAYNNNNRTG 1 cut(s) 188
SmlI CTYRAG 1 cut(s) 121
SmoI CTYRAG 1 cut(s) 121
StyD4I CCNGG 1 cut(s) 98
TaqI TCGA 1 cut(s) 211
TatI WGTACW 1 cut(s) 155
TfiI GAWTC 2 cut(s) 5, 259
Tru1I TTAA 3 cut(s) 75, 239, 272
Tru9I TTAA 3 cut(s) 75, 239, 272
TseFI GTSAC 1 cut(s) 107
Tsp45I GTSAC 1 cut(s) 107
TspDTI ATGAA 2 cut(s) 38, 57
TspGWI ACGGA 1 cut(s) 205
ZrmI AGTACT 1 cut(s) 157
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.