pycom10g02990

regulator of chromosome condensation (RCC1) family protein

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr10
N/A
Physical Location & Seq
Forward (+)
3362037 .. 3362822
786 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 240 bp
ATGGTAGGGGCTAATTGGTGGTGGCTGGACATTGTTTGTGATCGCGAGCACACCACCTCTGCTGCCTCAGATGGGTTGCTTTTCACTTGGGGTGCTAGAGATTACTTACTAGTTACAACTATGCTAAATCAATGGAAGAGTGGGGTTCGCTCTGTAATACACATTGAAGGTTCACGGTCCTTCAACCGATGTCGAGAACTGAAAATTTTGATCGCAAGGTTTGGTGAACCGTTGTCTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
Pfam Domains
Protein Families

Protein Analysis

80

Amino Acids

9.08

Weight (kDa)

7.85

Isoelectric Point (pI)

28.17

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccII CGCG 1 cut(s) 45
AcsI RAATTY 1 cut(s) 204
AfiI CCNNNNNNNGG 1 cut(s) 72
AgsI TTSAA 2 cut(s) 167, 184
AhlI ACTAGT 1 cut(s) 109
Alw21I GWGCWC 1 cut(s) 51
ApeKI GCWGC 1 cut(s) 62
ApoI RAATTY 1 cut(s) 204
AspS9I GGNCC 1 cut(s) 177
AsuHPI GGTGA 1 cut(s) 236
AvaII GGWCC 1 cut(s) 177
Bbv12I GWGCWC 1 cut(s) 51
BbvI GCAGC 1 cut(s) 49
BccI CCATC 1 cut(s) 65
BcuI ACTAGT 1 cut(s) 109
BfaI CTAG 2 cut(s) 96, 110
BisI GCNGC 1 cut(s) 63
BlsI GCNGC 1 cut(s) 64
Bme18I GGWCC 1 cut(s) 177
BmgT120I GGNCC 1 cut(s) 177
Bsc4I CCNNNNNNNGG 1 cut(s) 72
BseLI CCNNNNNNNGG 1 cut(s) 72
BseMII CTCAG 1 cut(s) 81
BseXI GCAGC 1 cut(s) 49
Bsh1236I CGCG 1 cut(s) 45
BsiHKAI GWGCWC 1 cut(s) 51
BslI CCNNNNNNNGG 1 cut(s) 72
Bsp1286I GDGCHC 1 cut(s) 51
Bsp143I GATC 2 cut(s) 40, 210
Bsp68I TCGCGA 1 cut(s) 45
BspCNI CTCAG 1 cut(s) 80
BspFNI CGCG 1 cut(s) 45
BssMI GATC 2 cut(s) 40, 210
Bst4CI ACNGT 2 cut(s) 177, 231
Bst6I CTCTTC 1 cut(s) 131
BstC8I GCNNGC 1 cut(s) 47
BstDEI CTNAG 1 cut(s) 67
BstFNI CGCG 1 cut(s) 45
BstKTI GATC 2 cut(s) 43, 213
BstMBI GATC 2 cut(s) 40, 210
BstUI CGCG 1 cut(s) 45
BstV1I GCAGC 1 cut(s) 49
BtuMI TCGCGA 1 cut(s) 45
Cac8I GCNNGC 1 cut(s) 47
Cfr13I GGNCC 1 cut(s) 177
CviJI RGCY 2 cut(s) 11, 25
CviKI_1 RGCY 2 cut(s) 11, 25
DdeI CTNAG 1 cut(s) 67
DpnI GATC 2 cut(s) 42, 212
DpnII GATC 2 cut(s) 40, 210
Eam1104I CTCTTC 1 cut(s) 131
EarI CTCTTC 1 cut(s) 131
Eco47I GGWCC 1 cut(s) 177
FaiI YATR 1 cut(s) 122
Fnu4HI GCNGC 1 cut(s) 63
Fsp4HI GCNGC 1 cut(s) 63
FspBI CTAG 2 cut(s) 96, 110
GluI GCNGC 1 cut(s) 63
HphI GGTGA 1 cut(s) 236
Hpy166II GTNNAC 2 cut(s) 173, 227
Hpy188I TCNGA 1 cut(s) 70
Hpy188III TCNNGA 3 cut(s) 44, 194, 237
Hpy8I GTNNAC 2 cut(s) 173, 227
HpyAV CCTTC 2 cut(s) 161, 190
HpyCH4III ACNGT 2 cut(s) 177, 231
HpyF3I CTNAG 1 cut(s) 67
Kzo9I GATC 2 cut(s) 40, 210
LpnPI CCDG 1 cut(s) 11
Lsp1109I GCAGC 1 cut(s) 49
MaeI CTAG 2 cut(s) 96, 110
MaeIII GTNAC 1 cut(s) 112
MalI GATC 2 cut(s) 42, 212
MboI GATC 2 cut(s) 40, 210
MboII GAAGA 1 cut(s) 148
MhlI GDGCHC 1 cut(s) 51
MluCI AATT 2 cut(s) 13, 204
MnlI CCTC 2 cut(s) 67, 76
MvnI CGCG 1 cut(s) 45
NdeII GATC 2 cut(s) 40, 210
NruI TCGCGA 1 cut(s) 45
PkrI GCNGC 1 cut(s) 64
PspPI GGNCC 1 cut(s) 177
RruI TCGCGA 1 cut(s) 45
SatI GCNGC 1 cut(s) 63
Sau3AI GATC 2 cut(s) 40, 210
Sau96I GGNCC 1 cut(s) 177
SduI GDGCHC 1 cut(s) 51
SetI ASST 3 cut(s) 59, 172, 221
SgeI CNNG 9 cut(s) 38, 56, 58, 99, 108, 122, 186, 206, 228
SinI GGWCC 1 cut(s) 177
SpeI ACTAGT 1 cut(s) 109
Sse9I AATT 2 cut(s) 13, 204
SspMI CTAG 2 cut(s) 96, 110
TaaI ACNGT 2 cut(s) 177, 231
TaqI TCGA 1 cut(s) 193
TasI AATT 2 cut(s) 13, 204
TseI GCWGC 1 cut(s) 62
VpaK11BI GGWCC 1 cut(s) 177
XapI RAATTY 1 cut(s) 204
XspI CTAG 2 cut(s) 96, 110
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.