pycom10g04240

transferase activity, transferring hexosyl groups

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr10
N/A
Physical Location & Seq
Forward (+)
4474456 .. 4475192
737 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 549 bp
ATGATGTGGCATCTTCATCTTTACAGGCTAGCTAACAAAAAATCAGAATCCAACATTCCTAGCAACATAAAACACTGCAATGTGTTAGATGGTGTGCCAAAAAATCATGTCTTGAAAGGGCATCCAATGGAGATAGTACTGGAGTTATTCCTCAAGGCCACACTTGCAAATTACAAAATTGGAATAAAGAAGGAGGTGGCAGAGACAAGCAAGAAGGGTGTTGCATGGATTCATCTTTGGATACCCATGCCATGCAACCTCTCTGCTCACATTTACACTGGTCTTATCCGCCACGAGCTCTTTCCAAGTTATGTTGGCCTCGATAGTGATAACCAAATAGCTAATGGTGATGGTAACGACGACGATCCTTTGCAAAAAGATAATACTTTGGAAATTGTTCCAAGGCTGTCCACAATGCACATTGCGGACTTATCTGAAGAACTCGTCTTGAATTCCTATCAAGAGATAAATCCCACGCTCCTGAATAGCAATCTCAAATTGAGGGTGGAATACTCACAAAGCCAGGAGTGCTCAAGAGCTTGGAGCTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

183

Amino Acids

20.68

Weight (kDa)

6.29

Isoelectric Point (pI)

44.78

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 2 cut(s) 289, 425
AclWI GGATC 1 cut(s) 359
AcsI RAATTY 1 cut(s) 451
AcuI CTGAAG 1 cut(s) 456
AfaI GTAC 1 cut(s) 138
AgsI TTSAA 2 cut(s) 115, 451
AjnI CCWGG 1 cut(s) 522
AluBI AGCT 5 cut(s) 32, 298, 341, 539, 546
AluI AGCT 5 cut(s) 32, 298, 341, 539, 546
Alw21I GWGCWC 2 cut(s) 300, 533
Alw26I GTCTC 1 cut(s) 197
AlwI GGATC 1 cut(s) 359
AoxI GGCC 2 cut(s) 156, 316
ApoI RAATTY 1 cut(s) 451
Asp700I GAANNNNTTC 1 cut(s) 396
AsuHPI GGTGA 1 cut(s) 359
AsuNHI GCTAGC 1 cut(s) 28
BanII GRGCYC 1 cut(s) 300
BauI CACGAG 1 cut(s) 293
Bbv12I GWGCWC 2 cut(s) 300, 533
BccI CCATC 2 cut(s) 83, 344
BciT130I CCWGG 1 cut(s) 524
BciVI GTATCC 1 cut(s) 234
BcoDI GTCTC 1 cut(s) 197
BfaI CTAG 2 cut(s) 29, 60
BfuI GTATCC 1 cut(s) 234
BmcAI AGTACT 1 cut(s) 138
Bme1390I CCNGG 1 cut(s) 524
BmrFI CCNGG 1 cut(s) 524
BmsI GCATC 2 cut(s) 19, 130
BmtI GCTAGC 1 cut(s) 32
BpmI CTGGAG 1 cut(s) 161
BpuEI CTTGAG 2 cut(s) 137, 517
BsaJI CCNNGG 1 cut(s) 401
Bse1I ACTGG 2 cut(s) 144, 283
Bse3DI GCAATG 2 cut(s) 85, 420
BseBI CCWGG 1 cut(s) 524
BseDI CCNNGG 1 cut(s) 401
BseGI GGATG 1 cut(s) 121
BseMI GCAATG 2 cut(s) 85, 420
BseNI ACTGG 2 cut(s) 144, 283
BshFI GGCC 2 cut(s) 158, 318
BsiHKAI GWGCWC 2 cut(s) 300, 533
BsmAI GTCTC 1 cut(s) 197
BsnI GGCC 2 cut(s) 158, 318
Bsp1286I GDGCHC 2 cut(s) 300, 533
Bsp143I GATC 1 cut(s) 364
BspACI CCGC 2 cut(s) 289, 425
BspANI GGCC 2 cut(s) 158, 318
BspOI GCTAGC 1 cut(s) 32
BspPI GGATC 1 cut(s) 359
BsrDI GCAATG 2 cut(s) 85, 420
BsrI ACTGG 2 cut(s) 144, 283
BssECI CCNNGG 1 cut(s) 401
BssMI GATC 1 cut(s) 364
BssSI CACGAG 1 cut(s) 293
BssT1I CCWWGG 1 cut(s) 401
Bst2BI CACGAG 1 cut(s) 293
Bst2UI CCWGG 1 cut(s) 524
BstC8I GCNNGC 1 cut(s) 30
BstF5I GGATG 1 cut(s) 121
BstKTI GATC 1 cut(s) 367
BstMAI GTCTC 1 cut(s) 197
BstMBI GATC 1 cut(s) 364
BstMWI GCNNNNNNNGC 2 cut(s) 164, 528
BstNI CCWGG 1 cut(s) 524
BstSCI CCNGG 1 cut(s) 522
BsuI GTATCC 1 cut(s) 234
BsuRI GGCC 2 cut(s) 158, 318
BtsCI GGATG 1 cut(s) 121
BtsI GCAGTG 1 cut(s) 73
BtsIMutI CAGTG 2 cut(s) 73, 276
Cac8I GCNNGC 1 cut(s) 30
Csp6I GTAC 1 cut(s) 137
CviAII CATG 4 cut(s) 107, 225, 247, 252
CviQI GTAC 1 cut(s) 137
DpnI GATC 1 cut(s) 366
DpnII GATC 1 cut(s) 364
EciI GGCGGA 1 cut(s) 278
Ecl136II GAGCTC 1 cut(s) 298
Eco130I CCWWGG 1 cut(s) 401
Eco24I GRGCYC 1 cut(s) 300
Eco53kI GAGCTC 1 cut(s) 298
Eco57I CTGAAG 1 cut(s) 456
EcoICRI GAGCTC 1 cut(s) 298
EcoRI GAATTC 1 cut(s) 451
EcoRII CCWGG 1 cut(s) 522
EcoT14I CCWWGG 1 cut(s) 401
EcoT38I GRGCYC 1 cut(s) 300
ErhI CCWWGG 1 cut(s) 401
FaeI CATG 4 cut(s) 110, 228, 250, 255
FaiI YATR 6 cut(s) 68, 108, 226, 248, 253, 312
FatI CATG 4 cut(s) 106, 224, 246, 251
FokI GGATG 1 cut(s) 108
FriOI GRGCYC 1 cut(s) 300
FspBI CTAG 2 cut(s) 29, 60
GsuI CTGGAG 1 cut(s) 161
HaeIII GGCC 2 cut(s) 158, 318
Hin1II CATG 4 cut(s) 110, 228, 250, 255
HinfI GANTC 2 cut(s) 47, 229
HphI GGTGA 1 cut(s) 359
Hpy166II GTNNAC 1 cut(s) 411
Hpy188I TCNGA 2 cut(s) 46, 436
Hpy188III TCNNGA 5 cut(s) 112, 448, 461, 481, 534
Hpy8I GTNNAC 1 cut(s) 411
Hpy99I CGWCG 2 cut(s) 362, 365
HpyAV CCTTC 2 cut(s) 184, 208
HpyCH4V TGCA 6 cut(s) 78, 167, 224, 255, 373, 418
HpyF10VI GCNNNNNNNGC 2 cut(s) 164, 528
Hsp92II CATG 4 cut(s) 110, 228, 250, 255
Kzo9I GATC 1 cut(s) 364
LmnI GCTCC 2 cut(s) 483, 543
LpnPI CCDG 6 cut(s) 10, 125, 264, 494, 509, 536
LweI GCATC 2 cut(s) 19, 130
MaeI CTAG 2 cut(s) 29, 60
MaeIII GTNAC 1 cut(s) 353
MalI GATC 1 cut(s) 366
MboI GATC 1 cut(s) 364
MboII GAAGA 2 cut(s) 5, 449
MhlI GDGCHC 2 cut(s) 300, 533
MluCI AATT 5 cut(s) 169, 177, 393, 451, 497
MmeI TCCRAC 1 cut(s) 75
MnlI CCTC 5 cut(s) 161, 187, 269, 329, 495
MroXI GAANNNNTTC 1 cut(s) 396
MslI CAYNNNNRTG 1 cut(s) 78
MspR9I CCNGG 1 cut(s) 524
MvaI CCWGG 1 cut(s) 524
MwoI GCNNNNNNNGC 2 cut(s) 164, 528
NdeII GATC 1 cut(s) 364
NheI GCTAGC 1 cut(s) 28
NlaIII CATG 4 cut(s) 110, 228, 250, 255
PdmI GAANNNNTTC 1 cut(s) 396
PfeI GAWTC 2 cut(s) 47, 229
Psp124BI GAGCTC 1 cut(s) 300
Psp6I CCWGG 1 cut(s) 522
PspGI CCWGG 1 cut(s) 522
RsaI GTAC 1 cut(s) 138
RsaNI GTAC 1 cut(s) 137
RseI CAYNNNNRTG 1 cut(s) 78
SacI GAGCTC 1 cut(s) 300
Sau3AI GATC 1 cut(s) 364
ScaI AGTACT 1 cut(s) 138
ScrFI CCNGG 1 cut(s) 524
SduI GDGCHC 2 cut(s) 300, 533
SetI ASST 7 cut(s) 34, 198, 261, 300, 343, 541, 548
SfaNI GCATC 2 cut(s) 19, 130
SmiMI CAYNNNNRTG 1 cut(s) 78
SmlI CTYRAG 2 cut(s) 152, 532
SmoI CTYRAG 2 cut(s) 152, 532
Sse9I AATT 5 cut(s) 169, 177, 393, 451, 497
SsiI CCGC 2 cut(s) 289, 425
SspMI CTAG 2 cut(s) 29, 60
SstI GAGCTC 1 cut(s) 300
StyD4I CCNGG 1 cut(s) 522
StyI CCWWGG 1 cut(s) 401
TaqI TCGA 1 cut(s) 321
TasI AATT 5 cut(s) 169, 177, 393, 451, 497
TatI WGTACW 1 cut(s) 136
TfiI GAWTC 2 cut(s) 47, 229
TscAI CASTG 2 cut(s) 80, 283
TspDTI ATGAA 2 cut(s) 5, 221
TspRI CASTG 2 cut(s) 80, 283
XapI RAATTY 1 cut(s) 451
XcmI CCANNNNNNNNNTGG 1 cut(s) 341
XmnI GAANNNNTTC 1 cut(s) 396
XspI CTAG 2 cut(s) 29, 60
ZrmI AGTACT 1 cut(s) 138
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.