pycom10g05000

No description available

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr10
N/A
Physical Location & Seq
Forward (+)
5259760 .. 5260514
755 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 345 bp
ATGTGTAATCACCCAAAAGAGATCGATCCGCCTGAGGGGGAGTGTTTCACACTTTACCACATTGATTGGGCTATGTATCCAATAGATGATTTGAATATTCTTGTAGCATTTACAGCAATCTTGTTGATAACTTTTTGTGTCTCCTCTCCAGAAAACAGTCGGCCTATTCCTCAACCTCGAACCTACAAACCAGCACATTCGGCAGGAGATGAATACCTCCGCAGGTTTAAGAGGAATGCAGTTCTAGTAGCATCAGGTGTTGCTAGAAATGTGAATAGAGTGGGCAACTACGTGAAACAGAGTGTGGATGACATTCTGTACCCTTACCGTAGAAGGCCCAAGTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

115

Amino Acids

13.12

Weight (kDa)

8.84

Isoelectric Point (pI)

71.7

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 1 cut(s) 213
AciI CCGC 2 cut(s) 29, 220
AclWI GGATC 1 cut(s) 20
AfaI GTAC 1 cut(s) 320
AfiI CCNNNNNNNGG 1 cut(s) 35
AgsI TTSAA 1 cut(s) 94
Alw26I GTCTC 1 cut(s) 145
AlwI GGATC 1 cut(s) 20
AoxI GGCC 2 cut(s) 161, 335
AspS9I GGNCC 1 cut(s) 336
AxyI CCTNAGG 1 cut(s) 33
BciVI GTATCC 1 cut(s) 87
BcoDI GTCTC 1 cut(s) 145
BfaI CTAG 2 cut(s) 245, 264
BfuAI ACCTGC 1 cut(s) 213
BfuI GTATCC 1 cut(s) 87
BmgT120I GGNCC 1 cut(s) 336
BmsI GCATC 1 cut(s) 260
BpmI CTGGAG 1 cut(s) 132
Bsa29I ATCGAT 1 cut(s) 24
BsaAI YACGTR 1 cut(s) 292
Bsc4I CCNNNNNNNGG 1 cut(s) 35
Bse21I CCTNAGG 1 cut(s) 33
BseCI ATCGAT 1 cut(s) 24
BseGI GGATG 1 cut(s) 313
BseLI CCNNNNNNNGG 1 cut(s) 35
BseMII CTCAG 1 cut(s) 24
BseRI GAGGAG 1 cut(s) 133
BshFI GGCC 2 cut(s) 163, 337
BshVI ATCGAT 1 cut(s) 24
BslI CCNNNNNNNGG 1 cut(s) 35
BsmAI GTCTC 1 cut(s) 145
BsmI GAATGC 1 cut(s) 241
BsnI GGCC 2 cut(s) 163, 337
Bsp143I GATC 2 cut(s) 21, 25
BspACI CCGC 2 cut(s) 29, 220
BspANI GGCC 2 cut(s) 163, 337
BspCNI CTCAG 1 cut(s) 25
BspDI ATCGAT 1 cut(s) 24
BspMI ACCTGC 1 cut(s) 213
BspPI GGATC 1 cut(s) 20
BssMI GATC 2 cut(s) 21, 25
Bst4CI ACNGT 2 cut(s) 158, 329
BstBAI YACGTR 1 cut(s) 292
BstDEI CTNAG 1 cut(s) 33
BstF5I GGATG 1 cut(s) 313
BstKTI GATC 2 cut(s) 24, 28
BstMAI GTCTC 1 cut(s) 145
BstMBI GATC 2 cut(s) 21, 25
BstMWI GCNNNNNNNGC 2 cut(s) 113, 200
Bsu15I ATCGAT 1 cut(s) 24
Bsu36I CCTNAGG 1 cut(s) 33
BsuI GTATCC 1 cut(s) 87
BsuRI GGCC 2 cut(s) 163, 337
BsuTUI ATCGAT 1 cut(s) 24
BtsCI GGATG 1 cut(s) 313
BveI ACCTGC 1 cut(s) 213
Cfr13I GGNCC 1 cut(s) 336
ClaI ATCGAT 1 cut(s) 24
Csp6I GTAC 1 cut(s) 319
CspCI CAANNNNNGTGG 2 cut(s) 47, 82
CviJI RGCY 3 cut(s) 71, 163, 337
CviKI_1 RGCY 3 cut(s) 71, 163, 337
CviQI GTAC 1 cut(s) 319
DdeI CTNAG 1 cut(s) 33
DpnI GATC 2 cut(s) 23, 27
DpnII GATC 2 cut(s) 21, 25
EciI GGCGGA 1 cut(s) 18
Eco81I CCTNAGG 1 cut(s) 33
FaiI YATR 1 cut(s) 74
FokI GGATG 1 cut(s) 320
FspBI CTAG 2 cut(s) 245, 264
GsuI CTGGAG 1 cut(s) 132
HaeIII GGCC 2 cut(s) 163, 337
Hpy188III TCNNGA 1 cut(s) 149
HpyAV CCTTC 1 cut(s) 327
HpyCH4III ACNGT 2 cut(s) 158, 329
HpyCH4IV ACGT 1 cut(s) 291
HpyCH4V TGCA 1 cut(s) 239
HpyF10VI GCNNNNNNNGC 2 cut(s) 113, 200
HpyF3I CTNAG 1 cut(s) 33
HpySE526I ACGT 1 cut(s) 291
Kzo9I GATC 2 cut(s) 21, 25
LpnPI CCDG 6 cut(s) 45, 162, 189, 204, 208, 240
LweI GCATC 1 cut(s) 260
MaeI CTAG 2 cut(s) 245, 264
MaeII ACGT 1 cut(s) 291
MalI GATC 2 cut(s) 23, 27
MboI GATC 2 cut(s) 21, 25
MnlI CCTC 6 cut(s) 28, 154, 180, 186, 225, 227
MseI TTAA 1 cut(s) 228
Mva1269I GAATGC 1 cut(s) 241
MwoI GCNNNNNNNGC 2 cut(s) 113, 200
NdeII GATC 2 cut(s) 21, 25
PctI GAATGC 1 cut(s) 241
Ppu21I YACGTR 1 cut(s) 292
PspPI GGNCC 1 cut(s) 336
RsaI GTAC 1 cut(s) 320
RsaNI GTAC 1 cut(s) 319
SaqAI TTAA 1 cut(s) 228
Sau3AI GATC 2 cut(s) 21, 25
Sau96I GGNCC 1 cut(s) 336
SetI ASST 6 cut(s) 178, 185, 219, 227, 259, 294
SfaNI GCATC 1 cut(s) 260
SsiI CCGC 2 cut(s) 29, 220
SspI AATATT 1 cut(s) 97
SspMI CTAG 2 cut(s) 245, 264
TaaI ACNGT 2 cut(s) 158, 329
TaiI ACGT 1 cut(s) 294
TaqI TCGA 2 cut(s) 24, 178
Tru1I TTAA 1 cut(s) 228
Tru9I TTAA 1 cut(s) 228
TspDTI ATGAA 1 cut(s) 225
XspI CTAG 2 cut(s) 245, 264
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.