pycom10g10350

amidase C869.01

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr10
N/A
Physical Location & Seq
Forward (+)
13625862 .. 13626077
216 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 216 bp
ATGGAGAAACCAAACCTCCATCACTTCTCATCCTTACTTCTGGTTTTTCTGTTTACATTGTCGCTTGGGACTCAGACAACGACGGGCCGGAAATTCTCGATCAGGGAAGCCACCATTGATCGATCTCCAACTCGCTTTCAAGCACAACCAACTCACCTCAAGGCAACTTGTCCAGTTCTACCTTGGAGAAATCAAAAGACTCAACCCCTTCCTTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
Pfam Domains
Protein Families

Protein Analysis

72

Amino Acids

8.13

Weight (kDa)

10.95

Isoelectric Point (pI)

32.2

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 92
AgsI TTSAA 1 cut(s) 140
AoxI GGCC 1 cut(s) 85
ApoI RAATTY 1 cut(s) 92
AspS9I GGNCC 1 cut(s) 85
AsuHPI GGTGA 1 cut(s) 146
BccI CCATC 1 cut(s) 27
BmgT120I GGNCC 1 cut(s) 85
BpuEI CTTGAG 1 cut(s) 143
Bsa29I ATCGAT 1 cut(s) 121
BsaJI CCNNGG 1 cut(s) 182
BsaXI ACNNNNNCTCC 1 cut(s) 30
Bse1I ACTGG 1 cut(s) 173
BseCI ATCGAT 1 cut(s) 121
BseDI CCNNGG 1 cut(s) 182
BseGI GGATG 1 cut(s) 29
BseMII CTCAG 1 cut(s) 86
BseNI ACTGG 1 cut(s) 173
BshFI GGCC 1 cut(s) 87
BshVI ATCGAT 1 cut(s) 121
BsiSI CCGG 1 cut(s) 88
BslFI GGGAC 1 cut(s) 82
BsmFI GGGAC 1 cut(s) 82
BsnI GGCC 1 cut(s) 87
Bsp143I GATC 3 cut(s) 99, 118, 122
BspANI GGCC 1 cut(s) 87
BspCNI CTCAG 1 cut(s) 85
BspDI ATCGAT 1 cut(s) 121
BsrI ACTGG 1 cut(s) 173
BssECI CCNNGG 1 cut(s) 182
BssMI GATC 3 cut(s) 99, 118, 122
BssT1I CCWWGG 1 cut(s) 182
BstDEI CTNAG 1 cut(s) 72
BstF5I GGATG 1 cut(s) 29
BstKTI GATC 3 cut(s) 102, 121, 125
BstMBI GATC 3 cut(s) 99, 118, 122
Bsu15I ATCGAT 1 cut(s) 121
BsuRI GGCC 1 cut(s) 87
BsuTUI ATCGAT 1 cut(s) 121
BtsCI GGATG 1 cut(s) 29
Cfr13I GGNCC 1 cut(s) 85
ClaI ATCGAT 1 cut(s) 121
CviJI RGCY 2 cut(s) 87, 110
CviKI_1 RGCY 2 cut(s) 87, 110
DdeI CTNAG 1 cut(s) 72
DpnI GATC 3 cut(s) 101, 120, 124
DpnII GATC 3 cut(s) 99, 118, 122
Eco130I CCWWGG 1 cut(s) 182
EcoT14I CCWWGG 1 cut(s) 182
ErhI CCWWGG 1 cut(s) 182
FaqI GGGAC 1 cut(s) 82
FokI GGATG 1 cut(s) 16
HaeIII GGCC 1 cut(s) 87
HapII CCGG 1 cut(s) 88
HinfI GANTC 2 cut(s) 70, 199
HpaII CCGG 1 cut(s) 88
HphI GGTGA 1 cut(s) 146
Hpy166II GTNNAC 1 cut(s) 54
Hpy188I TCNGA 1 cut(s) 75
Hpy188III TCNNGA 1 cut(s) 97
Hpy8I GTNNAC 1 cut(s) 54
Hpy99I CGWCG 1 cut(s) 85
HpyF3I CTNAG 1 cut(s) 72
Kzo9I GATC 3 cut(s) 99, 118, 122
LpnPI CCDG 4 cut(s) 26, 88, 101, 186
MalI GATC 3 cut(s) 101, 120, 124
MboI GATC 3 cut(s) 99, 118, 122
MluCI AATT 1 cut(s) 92
MlyI GAGTC 2 cut(s) 64, 193
MmeI TCCRAC 1 cut(s) 152
MnlI CCTC 2 cut(s) 26, 167
MseI TTAA 1 cut(s) 214
MspI CCGG 1 cut(s) 88
NdeII GATC 3 cut(s) 99, 118, 122
PleI GAGTC 2 cut(s) 64, 193
PpsI GAGTC 2 cut(s) 64, 193
PspPI GGNCC 1 cut(s) 85
SaqAI TTAA 1 cut(s) 214
Sau3AI GATC 3 cut(s) 99, 118, 122
Sau96I GGNCC 1 cut(s) 85
SchI GAGTC 2 cut(s) 64, 193
SetI ASST 3 cut(s) 18, 159, 184
SmlI CTYRAG 1 cut(s) 158
SmoI CTYRAG 1 cut(s) 158
Sse9I AATT 1 cut(s) 92
StyI CCWWGG 1 cut(s) 182
TaqI TCGA 2 cut(s) 98, 121
TasI AATT 1 cut(s) 92
Tru1I TTAA 1 cut(s) 214
Tru9I TTAA 1 cut(s) 214
XapI RAATTY 1 cut(s) 92
XcmI CCANNNNNNNNNTGG 1 cut(s) 180
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.