pycom10g15450

Endoplasmic reticulum membrane protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr10
N/A
Physical Location & Seq
Forward (+)
18686308 .. 18686688
381 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 381 bp
ATGTATGCTATCTTTTATGTCAAACTGGACAAGAAAGCTGGGTCCTTAGCAGCTTTCCTATTGTTTCTCACCTGGGTTGGAGCCGGTATTCTTGCTAGTGGGCTAGGGTTTGGTAAGTCATGGAAGCTTGTTCTCGCTGTTCAGGTTTTCTGCTGGCCTGCACTGCTCATAGGCCATGGCGTTTTTGAGAAAAGATTACCAGGTGTTGCAGACAGCTTTGTTGAAGGACTTCTGATGGGGCCATACTTTGTGTTGCTTGAGTTTCTTCAATCGGCCTTTAGCTATGAACCGTATCCAGGGTTTAATAAAAGCGTGAAAGAAAAGATTGAAGCTGATATCAAAGCGTGGAAGGCGATCAAGAATCAAAAGAAACTCTCCTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
DUF962

Protein Analysis

127

Amino Acids

13.98

Weight (kDa)

9.46

Isoelectric Point (pI)

27.1

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Mpo1-like PF06127 36 - 90 6.6e-08 2-hydroxy-palmitic acid dioxygenase Mpo1-like
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfiI CCNNNNNNNGG 1 cut(s) 296
AgsI TTSAA 3 cut(s) 224, 269, 329
AjnI CCWGG 3 cut(s) 71, 199, 295
AluBI AGCT 6 cut(s) 38, 53, 127, 216, 282, 332
AluI AGCT 6 cut(s) 38, 53, 127, 216, 282, 332
AoxI GGCC 4 cut(s) 155, 172, 239, 273
ApeKI GCWGC 1 cut(s) 50
Asp700I GAANNNNTTC 1 cut(s) 228
AspS9I GGNCC 2 cut(s) 42, 239
AsuHPI GGTGA 1 cut(s) 61
AvaII GGWCC 1 cut(s) 42
BbvI GCAGC 1 cut(s) 62
BccI CCATC 1 cut(s) 229
BciT130I CCWGG 3 cut(s) 73, 201, 297
BciVI GTATCC 1 cut(s) 303
BfaI CTAG 2 cut(s) 96, 104
BfuI GTATCC 1 cut(s) 303
BisI GCNGC 1 cut(s) 51
BlsI GCNGC 1 cut(s) 52
Bme1390I CCNGG 3 cut(s) 73, 201, 297
Bme18I GGWCC 1 cut(s) 42
BmgT120I GGNCC 2 cut(s) 42, 239
BmiI GGNNCC 3 cut(s) 43, 82, 240
BmrFI CCNGG 3 cut(s) 73, 201, 297
Bpu10I CCTNAGC 1 cut(s) 46
BpuEI CTTGAG 1 cut(s) 278
BsaJI CCNNGG 3 cut(s) 72, 175, 296
Bsc4I CCNNNNNNNGG 1 cut(s) 296
Bse118I RCCGGY 1 cut(s) 83
Bse1I ACTGG 1 cut(s) 30
BseBI CCWGG 3 cut(s) 73, 201, 297
BseDI CCNNGG 3 cut(s) 72, 175, 296
BseLI CCNNNNNNNGG 1 cut(s) 296
BseNI ACTGG 1 cut(s) 30
BseXI GCAGC 1 cut(s) 62
BseYI CCCAGC 1 cut(s) 38
BsgI GTGCAG 1 cut(s) 144
BshFI GGCC 4 cut(s) 157, 174, 241, 275
BsiSI CCGG 1 cut(s) 84
BslI CCNNNNNNNGG 1 cut(s) 296
BsnI GGCC 4 cut(s) 157, 174, 241, 275
Bsp143I GATC 1 cut(s) 354
Bsp19I CCATGG 1 cut(s) 175
BspANI GGCC 4 cut(s) 157, 174, 241, 275
BspLI GGNNCC 3 cut(s) 43, 82, 240
BsrFI RCCGGY 1 cut(s) 83
BsrI ACTGG 1 cut(s) 30
BssAI RCCGGY 1 cut(s) 83
BssECI CCNNGG 3 cut(s) 72, 175, 296
BssMI GATC 1 cut(s) 354
BssT1I CCWWGG 1 cut(s) 175
Bst2UI CCWGG 3 cut(s) 73, 201, 297
Bst4CI ACNGT 1 cut(s) 291
BstC8I GCNNGC 2 cut(s) 155, 159
BstDEI CTNAG 1 cut(s) 46
BstDSI CCRYGG 1 cut(s) 175
BstKTI GATC 1 cut(s) 357
BstMBI GATC 1 cut(s) 354
BstMWI GCNNNNNNNGC 2 cut(s) 163, 350
BstNI CCWGG 3 cut(s) 73, 201, 297
BstSCI CCNGG 3 cut(s) 71, 199, 295
BstV1I GCAGC 1 cut(s) 62
BsuI GTATCC 1 cut(s) 303
BsuRI GGCC 4 cut(s) 157, 174, 241, 275
BtgI CCRYGG 1 cut(s) 175
BtsI GCAGTG 1 cut(s) 161
BtsIMutI CAGTG 1 cut(s) 161
Cac8I GCNNGC 2 cut(s) 155, 159
Cfr10I RCCGGY 1 cut(s) 83
Cfr13I GGNCC 2 cut(s) 42, 239
CsiI ACCWGGT 1 cut(s) 199
CviAII CATG 2 cut(s) 120, 176
DdeI CTNAG 1 cut(s) 46
DpnI GATC 1 cut(s) 356
DpnII GATC 1 cut(s) 354
Eco130I CCWWGG 1 cut(s) 175
Eco32I GATATC 1 cut(s) 337
Eco47I GGWCC 1 cut(s) 42
EcoO109I RGGNCCY 1 cut(s) 42
EcoRII CCWGG 3 cut(s) 71, 199, 295
EcoRV GATATC 1 cut(s) 337
EcoT14I CCWWGG 1 cut(s) 175
ErhI CCWWGG 1 cut(s) 175
FaeI CATG 2 cut(s) 123, 179
FaiI YATR 7 cut(s) 6, 18, 121, 170, 177, 244, 285
FatI CATG 2 cut(s) 119, 175
Fnu4HI GCNGC 1 cut(s) 51
Fsp4HI GCNGC 1 cut(s) 51
FspBI CTAG 2 cut(s) 96, 104
GluI GCNGC 1 cut(s) 51
GsaI CCCAGC 1 cut(s) 42
HaeIII GGCC 4 cut(s) 157, 174, 241, 275
HapII CCGG 1 cut(s) 84
Hin1II CATG 2 cut(s) 123, 179
HindIII AAGCTT 1 cut(s) 125
HinfI GANTC 1 cut(s) 361
HpaII CCGG 1 cut(s) 84
HphI GGTGA 1 cut(s) 61
Hpy188I TCNGA 1 cut(s) 234
Hpy188III TCNNGA 2 cut(s) 358, 378
HpyAV CCTTC 2 cut(s) 218, 343
HpyCH4III ACNGT 1 cut(s) 291
HpyCH4V TGCA 2 cut(s) 161, 209
HpyF10VI GCNNNNNNNGC 2 cut(s) 163, 350
HpyF3I CTNAG 1 cut(s) 46
Hsp92II CATG 2 cut(s) 123, 179
Kzo9I GATC 1 cut(s) 354
LmnI GCTCC 1 cut(s) 80
Lsp1109I GCAGC 1 cut(s) 62
MabI ACCWGGT 1 cut(s) 199
MaeI CTAG 2 cut(s) 96, 104
MalI GATC 1 cut(s) 356
MboI GATC 1 cut(s) 354
MboII GAAGA 1 cut(s) 257
MmeI TCCRAC 1 cut(s) 58
MroXI GAANNNNTTC 1 cut(s) 228
MseI TTAA 1 cut(s) 303
MspI CCGG 1 cut(s) 84
MspR9I CCNGG 3 cut(s) 73, 201, 297
MvaI CCWGG 3 cut(s) 73, 201, 297
MwoI GCNNNNNNNGC 2 cut(s) 163, 350
NcoI CCATGG 1 cut(s) 175
NdeII GATC 1 cut(s) 354
NlaIII CATG 2 cut(s) 123, 179
NlaIV GGNNCC 3 cut(s) 43, 82, 240
PdmI GAANNNNTTC 1 cut(s) 228
PfeI GAWTC 1 cut(s) 361
PkrI GCNGC 1 cut(s) 52
PpuMI RGGWCCY 1 cut(s) 42
Psp5II RGGWCCY 1 cut(s) 42
Psp6I CCWGG 3 cut(s) 71, 199, 295
PspFI CCCAGC 1 cut(s) 38
PspGI CCWGG 3 cut(s) 71, 199, 295
PspN4I GGNNCC 3 cut(s) 43, 82, 240
PspPI GGNCC 2 cut(s) 42, 239
PspPPI RGGWCCY 1 cut(s) 42
SaqAI TTAA 1 cut(s) 303
SatI GCNGC 1 cut(s) 51
Sau3AI GATC 1 cut(s) 354
Sau96I GGNCC 2 cut(s) 42, 239
ScrFI CCNGG 3 cut(s) 73, 201, 297
SetI ASST 9 cut(s) 40, 55, 74, 129, 147, 205, 218, 284, 334
SexAI ACCWGGT 1 cut(s) 199
SinI GGWCC 1 cut(s) 42
SmlI CTYRAG 1 cut(s) 257
SmoI CTYRAG 1 cut(s) 257
SspMI CTAG 2 cut(s) 96, 104
StyD4I CCNGG 3 cut(s) 71, 199, 295
StyI CCWWGG 1 cut(s) 175
TaaI ACNGT 1 cut(s) 291
TfiI GAWTC 1 cut(s) 361
Tru1I TTAA 1 cut(s) 303
Tru9I TTAA 1 cut(s) 303
TscAI CASTG 1 cut(s) 168
TseI GCWGC 1 cut(s) 50
TspDTI ATGAA 1 cut(s) 300
TspRI CASTG 1 cut(s) 168
VpaK11BI GGWCC 1 cut(s) 42
XmnI GAANNNNTTC 1 cut(s) 228
XspI CTAG 2 cut(s) 96, 104
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.