pycom10g15590

Carbon catabolite repressor protein 4 homolog

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr10
N/A
Physical Location & Seq
Reverse (-)
18830249 .. 18831976
1728 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 342 bp
ATGGGAAGTTGCAAAAAAAAGCTTCAGAAAGCATTTCAAATTGCTAACATTGCCATCCTTTCTCTCGCACGCCCTCCTTTCGCAGAACACTCAGAGATTCACACACACCCTTTTCTCCTTTGTTGCCTGCCTCTGCACTTCTTCCTCCTCATTTTCCTCTCTCTCTCTCCATCAGCCTCAGCACCACAGACACCGCCATGGCCTTCCCTTCTTCTCTTGCCGTGGCCTTCCTTTATTCCTTTGGTTGAAACCCTCATCCATGCACTTGAGAAAATTGCCAAGTTGAAGATTCCCCTGGTGATTTGTGCAGATTTGAACTTTGTGCCTCAAAGACAATGTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
Pfam Domains
Protein Families

Protein Analysis

114

Amino Acids

12.63

Weight (kDa)

8.97

Isoelectric Point (pI)

47.99

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 194
AcuI CTGAAG 1 cut(s) 8
AgsI TTSAA 4 cut(s) 38, 248, 286, 316
AjnI CCWGG 1 cut(s) 294
AluBI AGCT 1 cut(s) 22
AluI AGCT 1 cut(s) 22
AoxI GGCC 2 cut(s) 200, 224
AsuHPI GGTGA 1 cut(s) 310
BbvCI CCTCAGC 1 cut(s) 178
BccI CCATC 2 cut(s) 62, 178
BceAI ACGGC 1 cut(s) 205
BciT130I CCWGG 1 cut(s) 296
Bme1390I CCNGG 1 cut(s) 296
BmrFI CCNGG 1 cut(s) 296
Bpu10I CCTNAGC 1 cut(s) 178
BpuEI CTTGAG 1 cut(s) 287
BsaJI CCNNGG 3 cut(s) 197, 221, 294
Bse3DI GCAATG 1 cut(s) 48
BseBI CCWGG 1 cut(s) 296
BseDI CCNNGG 3 cut(s) 197, 221, 294
BseGI GGATG 2 cut(s) 54, 255
BseMI GCAATG 1 cut(s) 48
BseMII CTCAG 2 cut(s) 105, 192
BseRI GAGGAG 1 cut(s) 137
BsgI GTGCAG 2 cut(s) 119, 327
BshFI GGCC 2 cut(s) 202, 226
BsnI GGCC 2 cut(s) 202, 226
Bsp19I CCATGG 1 cut(s) 197
BspACI CCGC 1 cut(s) 194
BspANI GGCC 2 cut(s) 202, 226
BspCNI CTCAG 2 cut(s) 104, 191
BsrDI GCAATG 1 cut(s) 48
BssECI CCNNGG 3 cut(s) 197, 221, 294
BssT1I CCWWGG 1 cut(s) 197
Bst2UI CCWGG 1 cut(s) 296
BstC8I GCNNGC 2 cut(s) 70, 128
BstDEI CTNAG 2 cut(s) 91, 178
BstDSI CCRYGG 2 cut(s) 197, 221
BstF5I GGATG 2 cut(s) 54, 255
BstMWI GCNNNNNNNGC 1 cut(s) 50
BstNI CCWGG 1 cut(s) 296
BstSCI CCNGG 1 cut(s) 294
BsuRI GGCC 2 cut(s) 202, 226
BtgI CCRYGG 2 cut(s) 197, 221
BtsCI GGATG 2 cut(s) 54, 255
Cac8I GCNNGC 2 cut(s) 70, 128
CviAII CATG 2 cut(s) 198, 260
CviJI RGCY 4 cut(s) 22, 176, 202, 226
CviKI_1 RGCY 4 cut(s) 22, 176, 202, 226
DdeI CTNAG 2 cut(s) 91, 178
Eco130I CCWWGG 1 cut(s) 197
Eco57I CTGAAG 1 cut(s) 8
EcoRII CCWGG 1 cut(s) 294
EcoT14I CCWWGG 1 cut(s) 197
ErhI CCWWGG 1 cut(s) 197
FaeI CATG 2 cut(s) 201, 263
FaiI YATR 2 cut(s) 199, 261
FatI CATG 2 cut(s) 197, 259
FokI GGATG 2 cut(s) 41, 242
HaeIII GGCC 2 cut(s) 202, 226
Hin1II CATG 2 cut(s) 201, 263
HindIII AAGCTT 1 cut(s) 20
HinfI GANTC 2 cut(s) 97, 289
HphI GGTGA 1 cut(s) 310
Hpy188I TCNGA 2 cut(s) 27, 94
HpyAV CCTTC 3 cut(s) 213, 218, 237
HpyCH4V TGCA 4 cut(s) 12, 136, 263, 308
HpyF10VI GCNNNNNNNGC 1 cut(s) 50
HpyF3I CTNAG 2 cut(s) 91, 178
Hsp92II CATG 2 cut(s) 201, 263
LpnPI CCDG 3 cut(s) 140, 281, 308
MboII GAAGA 3 cut(s) 133, 203, 298
MluCI AATT 2 cut(s) 39, 273
MnlI CCTC 8 cut(s) 84, 141, 155, 158, 167, 187, 263, 336
MslI CAYNNNNRTG 1 cut(s) 196
MspR9I CCNGG 1 cut(s) 296
MvaI CCWGG 1 cut(s) 296
MwoI GCNNNNNNNGC 1 cut(s) 50
NcoI CCATGG 1 cut(s) 197
NlaIII CATG 2 cut(s) 201, 263
PfeI GAWTC 2 cut(s) 97, 289
Psp6I CCWGG 1 cut(s) 294
PspGI CCWGG 1 cut(s) 294
RseI CAYNNNNRTG 1 cut(s) 196
ScrFI CCNGG 1 cut(s) 296
SetI ASST 1 cut(s) 24
SmiMI CAYNNNNRTG 1 cut(s) 196
SmlI CTYRAG 1 cut(s) 266
SmoI CTYRAG 1 cut(s) 266
Sse9I AATT 2 cut(s) 39, 273
SsiI CCGC 1 cut(s) 194
StyD4I CCNGG 1 cut(s) 294
StyI CCWWGG 1 cut(s) 197
TasI AATT 2 cut(s) 39, 273
TfiI GAWTC 2 cut(s) 97, 289
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.