pycom10g18110

microtubule motor activity

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr10
N/A
Physical Location & Seq
Forward (+)
21289898 .. 21290326
429 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 273 bp
ATGGACCTCCAGAATGATGTATTAGCTCAAGCCCCTCATTCTTTGGCCCACGCCATCGAACTCGCCCGTATCTATGACAATAAGCAACAACGACGTCATAGAACCTTCCGCCAATACTCTCATTGCCCTTCTCCGACATCTCTGACAGTGTCCTCGACGACATCTGCTCCACCCACAAGACCACTTCCCTCATCGCCAACTCGGCCACCGCTGCACTTATCTCCTGCAGAAGTCTGTGAGGGAAATTCGACTTCCTCTGGAGAAAAAAAGTGA

Protein Analysis

91

Amino Acids

9.89

Weight (kDa)

9.23

Isoelectric Point (pI)

81.48

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AatII GACGTC 1 cut(s) 97
AciI CCGC 2 cut(s) 109, 209
AcoI YGGCCR 1 cut(s) 203
AcsI RAATTY 1 cut(s) 244
AcyI GRCGYC 1 cut(s) 94
AluBI AGCT 1 cut(s) 26
AluI AGCT 1 cut(s) 26
AoxI GGCC 2 cut(s) 45, 203
ApeKI GCWGC 1 cut(s) 211
ApoI RAATTY 1 cut(s) 244
AspS9I GGNCC 2 cut(s) 4, 46
AvaII GGWCC 1 cut(s) 4
BbvI GCAGC 1 cut(s) 198
BccI CCATC 1 cut(s) 62
BfmI CTRYAG 1 cut(s) 225
BglI GCCNNNNNGGC 1 cut(s) 202
BisI GCNGC 1 cut(s) 212
BlsI GCNGC 1 cut(s) 213
Bme18I GGWCC 1 cut(s) 4
BmgT120I GGNCC 2 cut(s) 4, 46
BpuEI CTTGAG 1 cut(s) 12
BsaHI GRCGYC 1 cut(s) 94
BsaXI ACNNNNNCTCC 2 cut(s) 151, 181
Bse3DI GCAATG 1 cut(s) 121
BseMI GCAATG 1 cut(s) 121
BseXI GCAGC 1 cut(s) 198
BsgI GTGCAG 1 cut(s) 197
BshFI GGCC 2 cut(s) 47, 205
BsnI GGCC 2 cut(s) 47, 205
BspACI CCGC 2 cut(s) 109, 209
BspANI GGCC 2 cut(s) 47, 205
BspMAI CTGCAG 1 cut(s) 229
BsrDI GCAATG 1 cut(s) 121
BssNI GRCGYC 1 cut(s) 94
Bst4CI ACNGT 1 cut(s) 148
BstACI GRCGYC 1 cut(s) 94
BstMWI GCNNNNNNNGC 2 cut(s) 202, 211
BstSFI CTRYAG 1 cut(s) 225
BstV1I GCAGC 1 cut(s) 198
BsuRI GGCC 2 cut(s) 47, 205
BtgZI GCGATG 1 cut(s) 177
BtsIMutI CAGTG 1 cut(s) 153
Cfr13I GGNCC 2 cut(s) 4, 46
CviJI RGCY 4 cut(s) 26, 32, 47, 205
CviKI_1 RGCY 4 cut(s) 26, 32, 47, 205
EaeI YGGCCR 1 cut(s) 203
EciI GGCGGA 1 cut(s) 98
Eco47I GGWCC 1 cut(s) 4
FaiI YATR 2 cut(s) 75, 99
Fnu4HI GCNGC 1 cut(s) 212
Fsp4HI GCNGC 1 cut(s) 212
GluI GCNGC 1 cut(s) 212
HaeIII GGCC 2 cut(s) 47, 205
Hin1I GRCGYC 1 cut(s) 94
Hpy188I TCNGA 2 cut(s) 135, 144
Hpy188III TCNNGA 2 cut(s) 10, 258
Hpy99I CGWCG 2 cut(s) 96, 160
HpyAV CCTTC 2 cut(s) 115, 138
HpyCH4III ACNGT 1 cut(s) 148
HpyCH4IV ACGT 1 cut(s) 94
HpyCH4V TGCA 2 cut(s) 214, 227
HpyF10VI GCNNNNNNNGC 2 cut(s) 202, 211
HpySE526I ACGT 1 cut(s) 94
Hsp92I GRCGYC 1 cut(s) 94
LmnI GCTCC 1 cut(s) 172
LpnPI CCDG 3 cut(s) 23, 237, 243
Lsp1109I GCAGC 1 cut(s) 198
MaeII ACGT 1 cut(s) 94
MluCI AATT 1 cut(s) 244
MmeI TCCRAC 1 cut(s) 158
MnlI CCTC 6 cut(s) 17, 45, 163, 199, 232, 265
MspA1I CMGCKG 1 cut(s) 211
MwoI GCNNNNNNNGC 2 cut(s) 202, 211
NmeAIII GCCGAG 1 cut(s) 181
PflFI GACNNNGTC 1 cut(s) 148
PkrI GCNGC 1 cut(s) 213
PspPI GGNCC 2 cut(s) 4, 46
PstI CTGCAG 1 cut(s) 229
PsyI GACNNNGTC 1 cut(s) 148
SatI GCNGC 1 cut(s) 212
Sau96I GGNCC 2 cut(s) 4, 46
SetI ASST 4 cut(s) 9, 28, 97, 107
SfcI CTRYAG 1 cut(s) 225
SgeI CNNG 9 cut(s) 22, 41, 62, 74, 78, 166, 189, 213, 236
SinI GGWCC 1 cut(s) 4
SmlI CTYRAG 1 cut(s) 27
SmoI CTYRAG 1 cut(s) 27
Sse9I AATT 1 cut(s) 244
SsiI CCGC 2 cut(s) 109, 209
TaaI ACNGT 1 cut(s) 148
TaiI ACGT 1 cut(s) 97
TaqI TCGA 3 cut(s) 57, 155, 248
TasI AATT 1 cut(s) 244
TscAI CASTG 1 cut(s) 153
TseI GCWGC 1 cut(s) 211
TspRI CASTG 1 cut(s) 153
Tth111I GACNNNGTC 1 cut(s) 148
VpaK11BI GGWCC 1 cut(s) 4
XapI RAATTY 1 cut(s) 244
ZraI GACGTC 1 cut(s) 95
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.