pycom10g22460

The RING-variant domain is a C4HC3 zinc-finger like motif found in a number of cellular and viral proteins. Some of these proteins have been shown both in vivo and in vitro to have ubiquitin E3 ligase activity.

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr10
N/A
Physical Location & Seq
Reverse (-)
24812300 .. 24814221
1922 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 390 bp
ATGGCCAGCTGCCAGAAGTGTTGCTATGGTTGGGAAATGTTGGATTGTTTCTCAGCGTCTATGGAGGCTTGCTTTGCCCTGGTCATCGTTTTTGTTCTCATCTTTGCCATTCTTGGCATAGCTTATGGTTTGCTTGCGGCCACGCCATGGTCCATGGCTATCCAAAAATCGCTCATCCTCTGGCCTCAAATTTTGATGCGTGTTCTCTCTCGACCCCTACTTTCACAAAGCACGCTCTTATTGTTCCAATTACCTATAACTTGGAGAGCATTGAGTTTTGAAGAGAGGAGAAGGTTGTATGCAGGTTTTCATGGCTTCTTCATCCATGAACATGTCTGTAGTGGGGAAGTAATTACAAGAAGTGGAGGCGAGACATTGGTTTATTGCTAA

Protein Analysis

130

Amino Acids

14.6

Weight (kDa)

7.59

Isoelectric Point (pI)

46.14

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 1 cut(s) 293
AccB7I CCANNNNNTGG 1 cut(s) 147
AciI CCGC 1 cut(s) 137
AcoI YGGCCR 2 cut(s) 3, 138
AcsI RAATTY 1 cut(s) 189
AfiI CCNNNNNNNGG 1 cut(s) 147
AflIII ACRYGT 1 cut(s) 331
AgsI TTSAA 1 cut(s) 281
AjnI CCWGG 1 cut(s) 78
AluBI AGCT 2 cut(s) 9, 122
AluI AGCT 2 cut(s) 9, 122
Alw26I GTCTC 1 cut(s) 365
AoxI GGCC 3 cut(s) 3, 138, 182
ApeKI GCWGC 1 cut(s) 9
ApoI RAATTY 1 cut(s) 189
AspS9I GGNCC 1 cut(s) 150
AvaII GGWCC 1 cut(s) 150
BalI TGGCCA 1 cut(s) 5
BciT130I CCWGG 1 cut(s) 80
BcoDI GTCTC 1 cut(s) 365
BfmI CTRYAG 1 cut(s) 337
BfuAI ACCTGC 1 cut(s) 293
BisI GCNGC 2 cut(s) 10, 138
BlsI GCNGC 2 cut(s) 11, 139
Bme1390I CCNGG 1 cut(s) 80
Bme18I GGWCC 1 cut(s) 150
BmgT120I GGNCC 1 cut(s) 150
BmrFI CCNGG 1 cut(s) 80
BmsI GCATC 1 cut(s) 186
BsaJI CCNNGG 3 cut(s) 78, 146, 153
Bsc4I CCNNNNNNNGG 1 cut(s) 147
BseBI CCWGG 1 cut(s) 80
BseDI CCNNGG 3 cut(s) 78, 146, 153
BseGI GGATG 2 cut(s) 174, 321
BseLI CCNNNNNNNGG 1 cut(s) 147
BseMII CTCAG 1 cut(s) 66
BseRI GAGGAG 1 cut(s) 301
BshFI GGCC 3 cut(s) 5, 140, 184
BslI CCNNNNNNNGG 1 cut(s) 147
BsmAI GTCTC 1 cut(s) 365
BsnI GGCC 3 cut(s) 5, 140, 184
Bsp19I CCATGG 2 cut(s) 146, 153
BspACI CCGC 1 cut(s) 137
BspANI GGCC 3 cut(s) 5, 140, 184
BspCNI CTCAG 1 cut(s) 65
BspMI ACCTGC 1 cut(s) 293
BssECI CCNNGG 3 cut(s) 78, 146, 153
BssT1I CCWWGG 2 cut(s) 146, 153
Bst2UI CCWGG 1 cut(s) 80
Bst6I CTCTTC 1 cut(s) 276
BstC8I GCNNGC 4 cut(s) 7, 70, 135, 233
BstDEI CTNAG 1 cut(s) 52
BstDSI CCRYGG 2 cut(s) 146, 153
BstF5I GGATG 2 cut(s) 174, 321
BstMAI GTCTC 1 cut(s) 365
BstMWI GCNNNNNNNGC 1 cut(s) 74
BstNI CCWGG 1 cut(s) 80
BstNSI RCATGY 1 cut(s) 335
BstSCI CCNGG 1 cut(s) 78
BstSFI CTRYAG 1 cut(s) 337
BsuRI GGCC 3 cut(s) 5, 140, 184
BtgI CCRYGG 2 cut(s) 146, 153
BtsCI GGATG 2 cut(s) 174, 321
BveI ACCTGC 1 cut(s) 293
Cac8I GCNNGC 4 cut(s) 7, 70, 135, 233
Cfr13I GGNCC 1 cut(s) 150
CseI GACGC 1 cut(s) 45
CviAII CATG 5 cut(s) 147, 154, 311, 326, 332
CviJI RGCY 8 cut(s) 5, 9, 68, 122, 140, 158, 184, 315
CviKI_1 RGCY 8 cut(s) 5, 9, 68, 122, 140, 158, 184, 315
DdeI CTNAG 1 cut(s) 52
EaeI YGGCCR 2 cut(s) 3, 138
Eam1104I CTCTTC 1 cut(s) 276
EarI CTCTTC 1 cut(s) 276
Eco130I CCWWGG 2 cut(s) 146, 153
Eco47I GGWCC 1 cut(s) 150
EcoRII CCWGG 1 cut(s) 78
EcoT14I CCWWGG 2 cut(s) 146, 153
ErhI CCWWGG 2 cut(s) 146, 153
FaeI CATG 5 cut(s) 150, 157, 314, 329, 335
FatI CATG 5 cut(s) 146, 153, 310, 325, 331
Fnu4HI GCNGC 2 cut(s) 10, 138
FokI GGATG 2 cut(s) 161, 308
Fsp4HI GCNGC 2 cut(s) 10, 138
GluI GCNGC 2 cut(s) 10, 138
HaeIII GGCC 3 cut(s) 5, 140, 184
HgaI GACGC 1 cut(s) 45
Hin1II CATG 5 cut(s) 150, 157, 314, 329, 335
Hpy188III TCNNGA 1 cut(s) 210
HpyAV CCTTC 1 cut(s) 285
HpyCH4V TGCA 1 cut(s) 302
HpyF10VI GCNNNNNNNGC 1 cut(s) 74
HpyF3I CTNAG 1 cut(s) 52
Hsp92II CATG 5 cut(s) 150, 157, 314, 329, 335
LpnPI CCDG 6 cut(s) 19, 26, 65, 92, 166, 288
LweI GCATC 1 cut(s) 186
MboII GAAGA 2 cut(s) 293, 310
MlsI TGGCCA 1 cut(s) 5
MluCI AATT 3 cut(s) 189, 248, 351
MluNI TGGCCA 1 cut(s) 5
MmeI TCCRAC 1 cut(s) 21
MnlI CCTC 5 cut(s) 58, 188, 195, 279, 359
Mox20I TGGCCA 1 cut(s) 5
MscI TGGCCA 1 cut(s) 5
MslI CAYNNNNRTG 1 cut(s) 330
Msp20I TGGCCA 1 cut(s) 5
MspA1I CMGCKG 1 cut(s) 9
MspR9I CCNGG 1 cut(s) 80
MvaI CCWGG 1 cut(s) 80
MwoI GCNNNNNNNGC 1 cut(s) 74
NcoI CCATGG 2 cut(s) 146, 153
NlaIII CATG 5 cut(s) 150, 157, 314, 329, 335
NspI RCATGY 1 cut(s) 335
PciI ACATGT 1 cut(s) 331
PflMI CCANNNNNTGG 1 cut(s) 147
PkrI GCNGC 2 cut(s) 11, 139
PscI ACATGT 1 cut(s) 331
Psp6I CCWGG 1 cut(s) 78
PspGI CCWGG 1 cut(s) 78
PspPI GGNCC 1 cut(s) 150
PvuII CAGCTG 1 cut(s) 9
RseI CAYNNNNRTG 1 cut(s) 330
SatI GCNGC 2 cut(s) 10, 138
Sau96I GGNCC 1 cut(s) 150
ScrFI CCNGG 1 cut(s) 80
SetI ASST 5 cut(s) 11, 124, 256, 296, 307
SfaNI GCATC 1 cut(s) 186
SfcI CTRYAG 1 cut(s) 337
SinI GGWCC 1 cut(s) 150
SmiMI CAYNNNNRTG 1 cut(s) 330
Sse9I AATT 3 cut(s) 189, 248, 351
SsiI CCGC 1 cut(s) 137
StyD4I CCNGG 1 cut(s) 78
StyI CCWWGG 2 cut(s) 146, 153
TaqI TCGA 1 cut(s) 211
TasI AATT 3 cut(s) 189, 248, 351
TauI GCSGC 1 cut(s) 140
TseI GCWGC 1 cut(s) 9
TspDTI ATGAA 3 cut(s) 299, 310, 342
Van91I CCANNNNNTGG 1 cut(s) 147
VpaK11BI GGWCC 1 cut(s) 150
XapI RAATTY 1 cut(s) 189
XceI RCATGY 1 cut(s) 335
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.