pycom10g23310

(R)-mandelonitrile lyase

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr10
N/A
Physical Location & Seq
Forward (+)
25497294 .. 25497533
240 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 240 bp
ATGTATGATAATCCTCGCAATTTCATTAACATTTTGACCCCAAATGATCCATTGGAGCCCTCTATTGTGACGAGTCTAGCCATTACAAACAATTTCTACCAATGTTCTATCTCGCTCCCGCCGTATACGACTCCGGCTTACAGCCTTTTTCCTAGTTCTTCTTATCCCCTTCCAAATTCGACTTTTGCTCACTTTCCTAGCAAAGTTCCAGGACCTTTGCTCATGGTTCTCTCACGCTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
Pfam Domains
Protein Families

Protein Analysis

80

Amino Acids

8.78

Weight (kDa)

6.5

Isoelectric Point (pI)

52.15

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 125
AciI CCGC 1 cut(s) 119
AclWI GGATC 1 cut(s) 41
AcsI RAATTY 1 cut(s) 175
AjnI CCWGG 1 cut(s) 208
AlwI GGATC 1 cut(s) 41
ApoI RAATTY 1 cut(s) 175
AspS9I GGNCC 1 cut(s) 212
AvaII GGWCC 1 cut(s) 212
BanII GRGCYC 1 cut(s) 60
BceAI ACGGC 1 cut(s) 106
BciT130I CCWGG 1 cut(s) 210
BfaI CTAG 3 cut(s) 77, 153, 198
Bme1390I CCNGG 1 cut(s) 210
Bme18I GGWCC 1 cut(s) 212
BmgT120I GGNCC 1 cut(s) 212
BmiI GGNNCC 1 cut(s) 57
BmrFI CCNGG 1 cut(s) 210
BseBI CCWGG 1 cut(s) 210
BsiSI CCGG 1 cut(s) 134
Bsp1286I GDGCHC 1 cut(s) 60
Bsp143I GATC 1 cut(s) 46
BspACI CCGC 1 cut(s) 119
BspLI GGNNCC 1 cut(s) 57
BspPI GGATC 1 cut(s) 41
BssMI GATC 1 cut(s) 46
BssNAI GTATAC 1 cut(s) 126
Bst1107I GTATAC 1 cut(s) 126
Bst2UI CCWGG 1 cut(s) 210
BstKTI GATC 1 cut(s) 49
BstMBI GATC 1 cut(s) 46
BstNI CCWGG 1 cut(s) 210
BstSCI CCNGG 1 cut(s) 208
BstZ17I GTATAC 1 cut(s) 126
Cfr13I GGNCC 1 cut(s) 212
CviAII CATG 1 cut(s) 223
CviJI RGCY 4 cut(s) 58, 80, 137, 144
CviKI_1 RGCY 4 cut(s) 58, 80, 137, 144
DpnI GATC 1 cut(s) 48
DpnII GATC 1 cut(s) 46
Eco24I GRGCYC 1 cut(s) 60
Eco47I GGWCC 1 cut(s) 212
EcoO109I RGGNCCY 1 cut(s) 212
EcoRII CCWGG 1 cut(s) 208
EcoT38I GRGCYC 1 cut(s) 60
FaeI CATG 1 cut(s) 226
FaiI YATR 3 cut(s) 6, 126, 224
FatI CATG 1 cut(s) 222
FauI CCCGC 1 cut(s) 126
FblI GTMKAC 1 cut(s) 125
FriOI GRGCYC 1 cut(s) 60
FspBI CTAG 3 cut(s) 77, 153, 198
HapII CCGG 1 cut(s) 134
Hin1II CATG 1 cut(s) 226
HinfI GANTC 2 cut(s) 73, 130
HpaII CCGG 1 cut(s) 134
Hpy166II GTNNAC 1 cut(s) 126
Hpy8I GTNNAC 1 cut(s) 126
HpyAV CCTTC 1 cut(s) 179
Hsp92II CATG 1 cut(s) 226
Kzo9I GATC 1 cut(s) 46
LmnI GCTCC 2 cut(s) 55, 120
LpnPI CCDG 3 cut(s) 147, 195, 222
MaeI CTAG 3 cut(s) 77, 153, 198
MaeIII GTNAC 1 cut(s) 67
MalI GATC 1 cut(s) 48
MboI GATC 1 cut(s) 46
MboII GAAGA 1 cut(s) 150
MhlI GDGCHC 1 cut(s) 60
MluCI AATT 3 cut(s) 19, 91, 175
MlyI GAGTC 2 cut(s) 82, 124
MnlI CCTC 2 cut(s) 24, 70
MseI TTAA 1 cut(s) 27
MspI CCGG 1 cut(s) 134
MspR9I CCNGG 1 cut(s) 210
MvaI CCWGG 1 cut(s) 210
NdeII GATC 1 cut(s) 46
NlaIII CATG 1 cut(s) 226
NlaIV GGNNCC 1 cut(s) 57
NmuCI GTSAC 1 cut(s) 67
PcsI WCGNNNNNNNCGW 1 cut(s) 119
PfoI TCCNGGA 1 cut(s) 208
PleI GAGTC 2 cut(s) 81, 124
PpsI GAGTC 2 cut(s) 81, 124
PpuMI RGGWCCY 1 cut(s) 212
Psp5II RGGWCCY 1 cut(s) 212
Psp6I CCWGG 1 cut(s) 208
PspGI CCWGG 1 cut(s) 208
PspN4I GGNNCC 1 cut(s) 57
PspPI GGNCC 1 cut(s) 212
PspPPI RGGWCCY 1 cut(s) 212
SaqAI TTAA 1 cut(s) 27
Sau3AI GATC 1 cut(s) 46
Sau96I GGNCC 1 cut(s) 212
SchI GAGTC 2 cut(s) 82, 124
ScrFI CCNGG 1 cut(s) 210
SduI GDGCHC 1 cut(s) 60
SetI ASST 1 cut(s) 217
SinI GGWCC 1 cut(s) 212
Sse9I AATT 3 cut(s) 19, 91, 175
SsiI CCGC 1 cut(s) 119
SspMI CTAG 3 cut(s) 77, 153, 198
StyD4I CCNGG 1 cut(s) 208
TaqI TCGA 1 cut(s) 179
TasI AATT 3 cut(s) 19, 91, 175
Tru1I TTAA 1 cut(s) 27
Tru9I TTAA 1 cut(s) 27
TseFI GTSAC 1 cut(s) 67
Tsp45I GTSAC 1 cut(s) 67
TspDTI ATGAA 1 cut(s) 13
VpaK11BI GGWCC 1 cut(s) 212
XapI RAATTY 1 cut(s) 175
XmiI GTMKAC 1 cut(s) 125
XspI CTAG 3 cut(s) 77, 153, 198
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.