pycom10g27150

Serine--tRNA

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr10
N/A
Physical Location & Seq
Forward (+)
28207084 .. 28207422
339 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 339 bp
ATGATCCATATAAGATTTCAACTCTTTGCAAGTGTCAGATTTTCTTATCTTAATCTCACTCTCAGATTTTCATTCATCTTTTTATCCTCTCAATTTAAAAAGAGGTCTCTATATATCTATCACATCATTCATCATAGTTTCTCCATTCCATTTTCCTTGTATGAAACGAAATCCTGCCATGGTGTCGTTGAATGTTTGAAAACAATCCATGGATTTTACCTGAAAGGTGCTGGTGTGGCCCTTAGTCAAGCTCTGATAAACTTGATTCTTGATCTTCTTCAGAAAATGGGATATATGGAACTGCAGACCCCATTTTTCAAGAGCAAAGATGTCAAGTGA

Protein Analysis

113

Amino Acids

13.1

Weight (kDa)

9.74

Isoelectric Point (pI)

57.88

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcuI CTGAAG 1 cut(s) 263
AgsI TTSAA 4 cut(s) 20, 191, 199, 319
AluBI AGCT 1 cut(s) 251
AluI AGCT 1 cut(s) 251
Alw26I GTCTC 1 cut(s) 111
AoxI GGCC 1 cut(s) 237
AspS9I GGNCC 1 cut(s) 238
BcoDI GTCTC 1 cut(s) 111
BfmI CTRYAG 1 cut(s) 302
BmgT120I GGNCC 1 cut(s) 238
BsaI GGTCTC 1 cut(s) 111
BsaJI CCNNGG 2 cut(s) 178, 208
BseDI CCNNGG 2 cut(s) 178, 208
BseMII CTCAG 1 cut(s) 76
BshFI GGCC 1 cut(s) 239
BsmAI GTCTC 1 cut(s) 111
BsnI GGCC 1 cut(s) 239
Bso31I GGTCTC 1 cut(s) 111
Bsp143I GATC 2 cut(s) 3, 271
Bsp19I CCATGG 2 cut(s) 178, 208
BspANI GGCC 1 cut(s) 239
BspCNI CTCAG 1 cut(s) 75
BspMAI CTGCAG 1 cut(s) 306
BspTNI GGTCTC 1 cut(s) 111
BssECI CCNNGG 2 cut(s) 178, 208
BssMI GATC 2 cut(s) 3, 271
BssT1I CCWWGG 2 cut(s) 178, 208
BstDEI CTNAG 2 cut(s) 62, 242
BstDSI CCRYGG 2 cut(s) 178, 208
BstKTI GATC 2 cut(s) 6, 274
BstMAI GTCTC 1 cut(s) 111
BstMBI GATC 2 cut(s) 3, 271
BstMWI GCNNNNNNNGC 1 cut(s) 236
BstSFI CTRYAG 1 cut(s) 302
BsuRI GGCC 1 cut(s) 239
BtgI CCRYGG 2 cut(s) 178, 208
Cfr13I GGNCC 1 cut(s) 238
CviAII CATG 2 cut(s) 179, 209
CviJI RGCY 2 cut(s) 239, 251
CviKI_1 RGCY 2 cut(s) 239, 251
DdeI CTNAG 2 cut(s) 62, 242
DpnI GATC 2 cut(s) 5, 273
DpnII GATC 2 cut(s) 3, 271
DraI TTTAAA 1 cut(s) 97
Eco130I CCWWGG 2 cut(s) 178, 208
Eco31I GGTCTC 1 cut(s) 111
Eco57I CTGAAG 1 cut(s) 263
EcoT14I CCWWGG 2 cut(s) 178, 208
ErhI CCWWGG 2 cut(s) 178, 208
FaeI CATG 2 cut(s) 182, 212
FatI CATG 2 cut(s) 178, 208
HaeIII GGCC 1 cut(s) 239
Hin1II CATG 2 cut(s) 182, 212
HinfI GANTC 1 cut(s) 265
Hpy188I TCNGA 4 cut(s) 38, 65, 255, 282
Hpy188III TCNNGA 2 cut(s) 269, 319
HpyCH4V TGCA 2 cut(s) 29, 304
HpyF10VI GCNNNNNNNGC 1 cut(s) 236
HpyF3I CTNAG 2 cut(s) 62, 242
Hsp92II CATG 2 cut(s) 182, 212
Kzo9I GATC 2 cut(s) 3, 271
LpnPI CCDG 3 cut(s) 187, 216, 233
MalI GATC 2 cut(s) 5, 273
MboI GATC 2 cut(s) 3, 271
MboII GAAGA 2 cut(s) 266, 269
MluCI AATT 1 cut(s) 92
MnlI CCTC 2 cut(s) 96, 97
MseI TTAA 2 cut(s) 51, 96
MwoI GCNNNNNNNGC 1 cut(s) 236
NcoI CCATGG 2 cut(s) 178, 208
NdeII GATC 2 cut(s) 3, 271
NlaIII CATG 2 cut(s) 182, 212
PfeI GAWTC 1 cut(s) 265
PspPI GGNCC 1 cut(s) 238
PstI CTGCAG 1 cut(s) 306
SaqAI TTAA 2 cut(s) 51, 96
Sau3AI GATC 2 cut(s) 3, 271
Sau96I GGNCC 1 cut(s) 238
SetI ASST 4 cut(s) 107, 222, 229, 253
SfcI CTRYAG 1 cut(s) 302
Sse9I AATT 1 cut(s) 92
StyI CCWWGG 2 cut(s) 178, 208
TasI AATT 1 cut(s) 92
TfiI GAWTC 1 cut(s) 265
Tru1I TTAA 2 cut(s) 51, 96
Tru9I TTAA 2 cut(s) 51, 96
TspDTI ATGAA 4 cut(s) 60, 64, 119, 177
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.