pycom10g28900

Sister chromatid cohesion protein PDS5 homolog

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr10
N/A
Physical Location & Seq
Forward (+)
29367876 .. 29368208
333 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 222 bp
ATGAATGTTATAGAACAGTGCGCAGGAAAGCTTGAATCTGGCATTAAACAGTTTCTTATATCATCAATGTCAGGAGACAACAAGTCTGAGAATCATCAGATTGATTACCATGAAGTCATCTATGATGTATATCGATGTGCTCCCCAAATCTTATCAGGAATTGTCCCATACCTAACAGGAGAACTGATCGATCAAGCTAGAAACTCGTTTAAAAGCGGTTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

74

Amino Acids

8.15

Weight (kDa)

5.11

Isoelectric Point (pI)

39.47

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
PDS5 PF20168 2 - 62 3.4e-10 Sister chromatid cohesion protein PDS5 protein
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc16I TGCGCA 1 cut(s) 22
AciI CCGC 1 cut(s) 216
AgsI TTSAA 1 cut(s) 35
AhdI GACNNNNNGTC 1 cut(s) 82
AluBI AGCT 2 cut(s) 31, 197
AluI AGCT 2 cut(s) 31, 197
Alw21I GWGCWC 1 cut(s) 142
Alw26I GTCTC 1 cut(s) 69
AspLEI GCGC 1 cut(s) 23
Bbv12I GWGCWC 1 cut(s) 142
BcoDI GTCTC 1 cut(s) 69
BfaI CTAG 1 cut(s) 198
BmeRI GACNNNNNGTC 1 cut(s) 82
Bsa29I ATCGAT 2 cut(s) 133, 189
BsaBI GATNNNNATC 1 cut(s) 129
Bse8I GATNNNNATC 1 cut(s) 129
BseCI ATCGAT 2 cut(s) 133, 189
BseJI GATNNNNATC 1 cut(s) 129
BseMII CTCAG 1 cut(s) 78
BshVI ATCGAT 2 cut(s) 133, 189
BsiHKAI GWGCWC 1 cut(s) 142
BslFI GGGAC 1 cut(s) 149
BsmAI GTCTC 1 cut(s) 69
BsmFI GGGAC 1 cut(s) 149
Bsp1286I GDGCHC 1 cut(s) 142
Bsp143I GATC 2 cut(s) 186, 190
BspACI CCGC 1 cut(s) 216
BspCNI CTCAG 1 cut(s) 79
BspDI ATCGAT 2 cut(s) 133, 189
BssMI GATC 2 cut(s) 186, 190
Bst4CI ACNGT 2 cut(s) 18, 51
BstDEI CTNAG 1 cut(s) 87
BstHHI GCGC 1 cut(s) 23
BstKTI GATC 2 cut(s) 189, 193
BstMAI GTCTC 1 cut(s) 69
BstMBI GATC 2 cut(s) 186, 190
Bsu15I ATCGAT 2 cut(s) 133, 189
BsuTUI ATCGAT 2 cut(s) 133, 189
BtsIMutI CAGTG 1 cut(s) 23
CfoI GCGC 1 cut(s) 23
ClaI ATCGAT 2 cut(s) 133, 189
CviAII CATG 1 cut(s) 110
CviJI RGCY 2 cut(s) 31, 197
CviKI_1 RGCY 2 cut(s) 31, 197
DdeI CTNAG 1 cut(s) 87
DpnI GATC 2 cut(s) 188, 192
DpnII GATC 2 cut(s) 186, 190
DraI TTTAAA 1 cut(s) 211
DriI GACNNNNNGTC 1 cut(s) 82
Eam1105I GACNNNNNGTC 1 cut(s) 82
FaeI CATG 1 cut(s) 113
FaiI YATR 6 cut(s) 11, 59, 111, 123, 130, 169
FaqI GGGAC 1 cut(s) 149
FatI CATG 1 cut(s) 109
FspBI CTAG 1 cut(s) 198
FspI TGCGCA 1 cut(s) 22
GlaI GCGC 1 cut(s) 22
HhaI GCGC 1 cut(s) 23
Hin1II CATG 1 cut(s) 113
Hin6I GCGC 1 cut(s) 21
HinP1I GCGC 1 cut(s) 21
HindIII AAGCTT 1 cut(s) 29
HinfI GANTC 2 cut(s) 35, 91
Hpy188I TCNGA 2 cut(s) 88, 99
Hpy188III TCNNGA 2 cut(s) 72, 156
HpyCH4III ACNGT 2 cut(s) 18, 51
HpyF3I CTNAG 1 cut(s) 87
Hsp92II CATG 1 cut(s) 113
HspAI GCGC 1 cut(s) 21
Kzo9I GATC 2 cut(s) 186, 190
LmnI GCTCC 1 cut(s) 145
LpnPI CCDG 5 cut(s) 9, 24, 57, 141, 162
MaeI CTAG 1 cut(s) 198
MalI GATC 2 cut(s) 188, 192
MboI GATC 2 cut(s) 186, 190
MhlI GDGCHC 1 cut(s) 142
MluCI AATT 1 cut(s) 159
MseI TTAA 2 cut(s) 45, 210
NdeII GATC 2 cut(s) 186, 190
NlaIII CATG 1 cut(s) 113
NsbI TGCGCA 1 cut(s) 22
PfeI GAWTC 2 cut(s) 35, 91
SaqAI TTAA 2 cut(s) 45, 210
Sau3AI GATC 2 cut(s) 186, 190
SduI GDGCHC 1 cut(s) 142
SetI ASST 3 cut(s) 33, 174, 199
Sse9I AATT 1 cut(s) 159
SsiI CCGC 1 cut(s) 216
SspMI CTAG 1 cut(s) 198
TaaI ACNGT 2 cut(s) 18, 51
TaqI TCGA 2 cut(s) 133, 189
TasI AATT 1 cut(s) 159
TfiI GAWTC 2 cut(s) 35, 91
Tru1I TTAA 2 cut(s) 45, 210
Tru9I TTAA 2 cut(s) 45, 210
TscAI CASTG 1 cut(s) 23
TspDTI ATGAA 2 cut(s) 17, 126
TspRI CASTG 1 cut(s) 23
XspI CTAG 1 cut(s) 198
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.