pycom111g01220

Ribosome-recycling factor

Basic Information

Type: gene
Biological Identity
pyrus_communis
SuperScaffold_111
N/A
Physical Location & Seq
Reverse (-)
786514 .. 786804
291 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 291 bp
ATGGGAGAAAGAGGTGAGTTTAACTTAAGAACACACTGCTCCCAAATTGATATGGGGTTTGGCTACAATACACCGGAGTATGGCATACTCCAGCACCTAGGGCCATTATATACAATTAGATTCAATTCAAAATTGGATCTAACGGTTATTGCAGAAAATTTAATTGATATGATGCAAGTTTTTGTTTTTCGGAATGGCTACATTTTCCAGGTTGATGAGTTGACTAAAAAGTTTGTCAAGACAGCAGAGGACTTATGCAAGGCAAAGGAGAAGGAGATCAGTTCAGGCTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

97

Amino Acids

11.04

Weight (kDa)

5.62

Isoelectric Point (pI)

13.69

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 144
AcsI RAATTY 1 cut(s) 157
AfiI CCNNNNNNNGG 1 cut(s) 80
AflII CTTAAG 1 cut(s) 25
AgsI TTSAA 2 cut(s) 124, 129
AjnI CCWGG 1 cut(s) 207
AlwI GGATC 1 cut(s) 144
AoxI GGCC 1 cut(s) 101
ApoI RAATTY 1 cut(s) 157
AspA2I CCTAGG 1 cut(s) 97
AspS9I GGNCC 1 cut(s) 101
AsuHPI GGTGA 1 cut(s) 26
AvrII CCTAGG 1 cut(s) 97
BciT130I CCWGG 1 cut(s) 209
BfaI CTAG 1 cut(s) 98
BfrI CTTAAG 1 cut(s) 25
BlnI CCTAGG 1 cut(s) 97
Bme1390I CCNGG 1 cut(s) 209
BmgT120I GGNCC 1 cut(s) 101
BmrFI CCNGG 1 cut(s) 209
BmsI GCATC 1 cut(s) 162
BpmI CTGGAG 1 cut(s) 74
BsaJI CCNNGG 1 cut(s) 97
BsaWI WCCGGW 1 cut(s) 73
Bsc4I CCNNNNNNNGG 1 cut(s) 80
BseBI CCWGG 1 cut(s) 209
BseDI CCNNGG 1 cut(s) 97
BseLI CCNNNNNNNGG 1 cut(s) 80
BshFI GGCC 1 cut(s) 103
BsiSI CCGG 1 cut(s) 74
BslI CCNNNNNNNGG 1 cut(s) 80
BsnI GGCC 1 cut(s) 103
Bsp143I GATC 2 cut(s) 136, 276
BspANI GGCC 1 cut(s) 103
BspPI GGATC 1 cut(s) 144
BspTI CTTAAG 1 cut(s) 25
BssECI CCNNGG 1 cut(s) 97
BssMI GATC 2 cut(s) 136, 276
BssT1I CCWWGG 1 cut(s) 97
Bst2UI CCWGG 1 cut(s) 209
Bst4CI ACNGT 1 cut(s) 145
BstAFI CTTAAG 1 cut(s) 25
BstKTI GATC 2 cut(s) 139, 279
BstMBI GATC 2 cut(s) 136, 276
BstMWI GCNNNNNNNGC 1 cut(s) 100
BstNI CCWGG 1 cut(s) 209
BstSCI CCNGG 1 cut(s) 207
BstX2I RGATCY 1 cut(s) 136
BstYI RGATCY 1 cut(s) 136
BsuRI GGCC 1 cut(s) 103
BtsI GCAGTG 1 cut(s) 34
BtsIMutI CAGTG 1 cut(s) 34
Cfr13I GGNCC 1 cut(s) 101
CviJI RGCY 4 cut(s) 63, 103, 198, 288
CviKI_1 RGCY 4 cut(s) 63, 103, 198, 288
DpnI GATC 2 cut(s) 138, 278
DpnII GATC 2 cut(s) 136, 276
Eco130I CCWWGG 1 cut(s) 97
EcoRII CCWGG 1 cut(s) 207
EcoT14I CCWWGG 1 cut(s) 97
ErhI CCWWGG 1 cut(s) 97
FaiI YATR 7 cut(s) 53, 81, 86, 109, 111, 170, 256
FspBI CTAG 1 cut(s) 98
GsuI CTGGAG 1 cut(s) 74
HaeIII GGCC 1 cut(s) 103
HapII CCGG 1 cut(s) 74
HincII GTYRAC 1 cut(s) 222
HindII GTYRAC 1 cut(s) 222
HinfI GANTC 1 cut(s) 120
HpaII CCGG 1 cut(s) 74
HphI GGTGA 1 cut(s) 26
Hpy166II GTNNAC 1 cut(s) 222
Hpy188I TCNGA 1 cut(s) 192
Hpy188III TCNNGA 1 cut(s) 238
Hpy8I GTNNAC 1 cut(s) 222
HpyAV CCTTC 1 cut(s) 265
HpyCH4III ACNGT 1 cut(s) 145
HpyCH4V TGCA 3 cut(s) 152, 175, 258
HpyF10VI GCNNNNNNNGC 1 cut(s) 100
Kzo9I GATC 2 cut(s) 136, 276
LmnI GCTCC 1 cut(s) 44
LpnPI CCDG 5 cut(s) 87, 104, 194, 221, 270
LweI GCATC 1 cut(s) 162
MaeI CTAG 1 cut(s) 98
MalI GATC 2 cut(s) 138, 278
MboI GATC 2 cut(s) 136, 276
MflI RGATCY 1 cut(s) 136
MluCI AATT 6 cut(s) 45, 114, 124, 131, 157, 162
MnlI CCTC 2 cut(s) 5, 241
MseI TTAA 3 cut(s) 21, 26, 161
MspCI CTTAAG 1 cut(s) 25
MspI CCGG 1 cut(s) 74
MspR9I CCNGG 1 cut(s) 209
MvaI CCWGG 1 cut(s) 209
MwoI GCNNNNNNNGC 1 cut(s) 100
NdeII GATC 2 cut(s) 136, 276
PfeI GAWTC 1 cut(s) 120
Psp6I CCWGG 1 cut(s) 207
PspGI CCWGG 1 cut(s) 207
PspPI GGNCC 1 cut(s) 101
PsuI RGATCY 1 cut(s) 136
SaqAI TTAA 3 cut(s) 21, 26, 161
Sau3AI GATC 2 cut(s) 136, 276
Sau96I GGNCC 1 cut(s) 101
ScrFI CCNGG 1 cut(s) 209
SetI ASST 3 cut(s) 16, 99, 213
SfaNI GCATC 1 cut(s) 162
SgeI CNNG 8 cut(s) 86, 103, 110, 188, 220, 221, 250, 271
SmlI CTYRAG 1 cut(s) 25
SmoI CTYRAG 1 cut(s) 25
Sse9I AATT 6 cut(s) 45, 114, 124, 131, 157, 162
SspMI CTAG 1 cut(s) 98
StyD4I CCNGG 1 cut(s) 207
StyI CCWWGG 1 cut(s) 97
TaaI ACNGT 1 cut(s) 145
TasI AATT 6 cut(s) 45, 114, 124, 131, 157, 162
TfiI GAWTC 1 cut(s) 120
Tru1I TTAA 3 cut(s) 21, 26, 161
Tru9I TTAA 3 cut(s) 21, 26, 161
TscAI CASTG 1 cut(s) 41
TspRI CASTG 1 cut(s) 41
Vha464I CTTAAG 1 cut(s) 25
XapI RAATTY 1 cut(s) 157
XmaJI CCTAGG 1 cut(s) 97
XspI CTAG 1 cut(s) 98
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.