pycom111g04340

Neddylation of cullins play an essential role in the regulation of SCF-type complexes activity

Basic Information

Type: gene
Biological Identity
pyrus_communis
SuperScaffold_111
N/A
Physical Location & Seq
Reverse (-)
2625671 .. 2626719
1049 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 198 bp
ATGGATCCGTCCGGGTCCACTCGATTCAACATCTTTGAGATTTATCGCCGATTCTGCGATATCAGGACAGGAAATGGATACGGTCACGGTGAAGGATACATAGAAAACGATGATTCACAGATGGCTAAATATTCAAGGAAGGCATTAACTCAGCTCTTATATCTGGTGGAATCAAAACTGCACGCTAGCAATTTTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

66

Amino Acids

7.51

Weight (kDa)

6.71

Isoelectric Point (pI)

35.84

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 12
AgsI TTSAA 2 cut(s) 28, 135
AluBI AGCT 1 cut(s) 154
AluI AGCT 1 cut(s) 154
AlwI GGATC 1 cut(s) 12
AspS9I GGNCC 1 cut(s) 15
AsuC2I CCSGG 1 cut(s) 13
AsuHPI GGTGA 1 cut(s) 101
AsuNHI GCTAGC 1 cut(s) 185
AvaII GGWCC 1 cut(s) 15
BamHI GGATCC 1 cut(s) 4
BccI CCATC 1 cut(s) 115
BciVI GTATCC 2 cut(s) 71, 89
BcnI CCSGG 1 cut(s) 13
BfaI CTAG 1 cut(s) 186
BfuI GTATCC 2 cut(s) 71, 89
Bme1390I CCNGG 1 cut(s) 13
Bme18I GGWCC 1 cut(s) 15
BmgT120I GGNCC 1 cut(s) 15
BmiI GGNNCC 2 cut(s) 6, 16
BmrFI CCNGG 1 cut(s) 13
BmtI GCTAGC 1 cut(s) 189
BpuMI CCSGG 1 cut(s) 13
BseMII CTCAG 1 cut(s) 164
BsgI GTGCAG 1 cut(s) 164
BsiSI CCGG 1 cut(s) 12
Bsp143I GATC 1 cut(s) 4
BspCNI CTCAG 1 cut(s) 163
BspLI GGNNCC 2 cut(s) 6, 16
BspOI GCTAGC 1 cut(s) 189
BspPI GGATC 1 cut(s) 12
BssMI GATC 1 cut(s) 4
Bst4CI ACNGT 2 cut(s) 83, 89
BstC8I GCNNGC 2 cut(s) 183, 187
BstDEI CTNAG 1 cut(s) 150
BstKTI GATC 1 cut(s) 7
BstMBI GATC 1 cut(s) 4
BstMWI GCNNNNNNNGC 1 cut(s) 54
BstSCI CCNGG 1 cut(s) 11
BstX2I RGATCY 1 cut(s) 4
BstYI RGATCY 1 cut(s) 4
BsuI GTATCC 2 cut(s) 71, 89
Cac8I GCNNGC 2 cut(s) 183, 187
Cfr13I GGNCC 1 cut(s) 15
CviJI RGCY 2 cut(s) 125, 154
CviKI_1 RGCY 2 cut(s) 125, 154
DdeI CTNAG 1 cut(s) 150
DpnI GATC 1 cut(s) 6
DpnII GATC 1 cut(s) 4
Eco32I GATATC 1 cut(s) 61
Eco47I GGWCC 1 cut(s) 15
EcoRV GATATC 1 cut(s) 61
FaiI YATR 2 cut(s) 101, 160
FspBI CTAG 1 cut(s) 186
HapII CCGG 1 cut(s) 12
HinfI GANTC 4 cut(s) 24, 51, 113, 170
HpaII CCGG 1 cut(s) 12
HphI GGTGA 1 cut(s) 101
Hpy166II GTNNAC 1 cut(s) 18
Hpy188III TCNNGA 1 cut(s) 64
Hpy8I GTNNAC 1 cut(s) 18
HpyAV CCTTC 2 cut(s) 86, 133
HpyCH4III ACNGT 2 cut(s) 83, 89
HpyCH4V TGCA 1 cut(s) 181
HpyF10VI GCNNNNNNNGC 1 cut(s) 54
HpyF3I CTNAG 1 cut(s) 150
Kzo9I GATC 1 cut(s) 4
LpnPI CCDG 4 cut(s) 25, 49, 54, 149
MaeI CTAG 1 cut(s) 186
MaeIII GTNAC 1 cut(s) 83
MalI GATC 1 cut(s) 6
MboI GATC 1 cut(s) 4
MflI RGATCY 1 cut(s) 4
MluCI AATT 1 cut(s) 190
MseI TTAA 1 cut(s) 146
MspI CCGG 1 cut(s) 12
MspR9I CCNGG 1 cut(s) 13
MwoI GCNNNNNNNGC 1 cut(s) 54
NciI CCSGG 1 cut(s) 13
NdeII GATC 1 cut(s) 4
NheI GCTAGC 1 cut(s) 185
NlaIV GGNNCC 2 cut(s) 6, 16
NmuCI GTSAC 1 cut(s) 83
PfeI GAWTC 4 cut(s) 24, 51, 113, 170
PspN4I GGNNCC 2 cut(s) 6, 16
PspPI GGNCC 1 cut(s) 15
PsuI RGATCY 1 cut(s) 4
SaqAI TTAA 1 cut(s) 146
Sau3AI GATC 1 cut(s) 4
Sau96I GGNCC 1 cut(s) 15
ScrFI CCNGG 1 cut(s) 13
SetI ASST 1 cut(s) 156
SgeI CNNG 9 cut(s) 24, 25, 33, 76, 81, 98, 147, 176, 194
SinI GGWCC 1 cut(s) 15
Sse9I AATT 1 cut(s) 190
SspI AATATT 1 cut(s) 131
SspMI CTAG 1 cut(s) 186
StyD4I CCNGG 1 cut(s) 11
TaaI ACNGT 2 cut(s) 83, 89
TaqI TCGA 1 cut(s) 22
TasI AATT 1 cut(s) 190
TfiI GAWTC 4 cut(s) 24, 51, 113, 170
Tru1I TTAA 1 cut(s) 146
Tru9I TTAA 1 cut(s) 146
TseFI GTSAC 1 cut(s) 83
Tsp45I GTSAC 1 cut(s) 83
VpaK11BI GGWCC 1 cut(s) 15
XspI CTAG 1 cut(s) 186
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.