pycom111g04920

Succinyl-CoA synthetase functions in the citric acid cycle (TCA), coupling the hydrolysis of succinyl-CoA to the synthesis of ATP and thus represents the only step of substrate- level phosphorylation in the TCA. The alpha subunit of the enzyme binds the substrates coenzyme A and phosphate, while succinate binding and nucleotide specificity is provided by the beta subunit

Basic Information

Type: gene
Biological Identity
pyrus_communis
SuperScaffold_111
N/A
Physical Location & Seq
Forward (+)
3028521 .. 3029070
550 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 444 bp
ATGGGTCGTCAAGCCGTAGCCAAGCTGATCGGTTCGATCGCATCGCGTAGAACATCTCCGTCAACGTCCTTACTTCAGCGCCGCCATTACTCCCCGGCTTCGCCACCGCCCCCCGCTGTCTTCGTTGACAAAAACACTCGCGTCATATGCCAAGGCATCACCGGCAAGAACGGCACTTTCCACACCAAGCAAGCCATCGAATATGGCACCAAAATGGTTTTTCTCAAACGCATTCAAACAGGCCGGGCCTTAGATGTGTATGGAATTTTACGTGAAATTTCTGCTAGTGATTTACACAAAGCCGAAAGCTCCGGAATCAATTACCAAATTACTGGCGCCACCAGAGATTATTTTGCTGTTTTACACTTTCGGGATTTCCTTTTGATTCTCGTGCTGCTTTGTTTAGGCTGGGTATCAGGGAAGGGGAAGGGTGTCGGTGGGTGA

Protein Analysis

148

Amino Acids

16.02

Weight (kDa)

10.24

Isoelectric Point (pI)

48.52

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 2 cut(s) 206, 335
AccII CGCG 2 cut(s) 46, 141
AccIII TCCGGA 1 cut(s) 311
AciI CCGC 3 cut(s) 82, 107, 114
AcsI RAATTY 2 cut(s) 264, 276
AcuI CTGAAG 1 cut(s) 59
AcyI GRCGYC 1 cut(s) 336
AgsI TTSAA 1 cut(s) 236
AluBI AGCT 2 cut(s) 25, 309
AluI AGCT 2 cut(s) 25, 309
Aor13HI TCCGGA 1 cut(s) 311
AoxI GGCC 2 cut(s) 241, 246
ApeKI GCWGC 1 cut(s) 394
ApoI RAATTY 2 cut(s) 264, 276
AspLEI GCGC 2 cut(s) 81, 338
AspS9I GGNCC 1 cut(s) 246
AsuC2I CCSGG 2 cut(s) 95, 245
AsuHPI GGTGA 1 cut(s) 151
BanI GGYRCC 2 cut(s) 206, 335
BauI CACGAG 1 cut(s) 389
BbsI GAAGAC 1 cut(s) 112
BbvI GCAGC 1 cut(s) 381
BccI CCATC 1 cut(s) 203
BceAI ACGGC 1 cut(s) 187
BcnI CCSGG 2 cut(s) 95, 245
BfaI CTAG 1 cut(s) 285
BfoI RGCGCY 2 cut(s) 82, 339
BisI GCNGC 2 cut(s) 82, 395
BlsI GCNGC 2 cut(s) 83, 396
Bme1390I CCNGG 2 cut(s) 95, 245
BmgT120I GGNCC 1 cut(s) 246
BmiI GGNNCC 2 cut(s) 208, 337
BmrFI CCNGG 2 cut(s) 95, 245
BmsI GCATC 2 cut(s) 50, 165
BpiI GAAGAC 1 cut(s) 112
BpuMI CCSGG 2 cut(s) 95, 245
BsaAI YACGTR 1 cut(s) 272
BsaHI GRCGYC 1 cut(s) 336
BsaJI CCNNGG 2 cut(s) 93, 151
BsaWI WCCGGW 1 cut(s) 311
Bse118I RCCGGY 1 cut(s) 161
Bse1I ACTGG 1 cut(s) 337
BseAI TCCGGA 1 cut(s) 311
BseDI CCNNGG 2 cut(s) 93, 151
BseNI ACTGG 1 cut(s) 337
BseXI GCAGC 1 cut(s) 381
BseYI CCCAGC 1 cut(s) 408
Bsh1236I CGCG 2 cut(s) 46, 141
Bsh1285I CGRYCG 1 cut(s) 39
BshFI GGCC 2 cut(s) 243, 248
BshNI GGYRCC 2 cut(s) 206, 335
BsiEI CGRYCG 1 cut(s) 39
BsiSI CCGG 4 cut(s) 95, 162, 244, 312
BsmI GAATGC 1 cut(s) 231
BsnI GGCC 2 cut(s) 243, 248
Bsp13I TCCGGA 1 cut(s) 311
Bsp143I GATC 2 cut(s) 27, 36
BspACI CCGC 3 cut(s) 82, 107, 114
BspANI GGCC 2 cut(s) 243, 248
BspEI TCCGGA 1 cut(s) 311
BspFNI CGCG 2 cut(s) 46, 141
BspLI GGNNCC 2 cut(s) 208, 337
BspT107I GGYRCC 2 cut(s) 206, 335
BsrFI RCCGGY 1 cut(s) 161
BsrI ACTGG 1 cut(s) 337
BssAI RCCGGY 1 cut(s) 161
BssECI CCNNGG 2 cut(s) 93, 151
BssMI GATC 2 cut(s) 27, 36
BssNI GRCGYC 1 cut(s) 336
BssSI CACGAG 1 cut(s) 389
BssT1I CCWWGG 1 cut(s) 151
Bst2BI CACGAG 1 cut(s) 389
BstACI GRCGYC 1 cut(s) 336
BstBAI YACGTR 1 cut(s) 272
BstC8I GCNNGC 1 cut(s) 192
BstDEI CTNAG 1 cut(s) 250
BstFNI CGCG 2 cut(s) 46, 141
BstH2I RGCGCY 2 cut(s) 82, 339
BstHHI GCGC 2 cut(s) 81, 338
BstKTI GATC 2 cut(s) 30, 39
BstMBI GATC 2 cut(s) 27, 36
BstMCI CGRYCG 1 cut(s) 39
BstMWI GCNNNNNNNGC 3 cut(s) 147, 162, 171
BstSCI CCNGG 2 cut(s) 93, 243
BstUI CGCG 2 cut(s) 46, 141
BstV1I GCAGC 1 cut(s) 381
BstV2I GAAGAC 1 cut(s) 112
BstXI CCANNNNNNTGG 1 cut(s) 332
BsuRI GGCC 2 cut(s) 243, 248
BtgZI GCGATG 1 cut(s) 27
Cac8I GCNNGC 1 cut(s) 192
CfoI GCGC 2 cut(s) 81, 338
Cfr10I RCCGGY 1 cut(s) 161
Cfr13I GGNCC 1 cut(s) 246
CseI GACGC 1 cut(s) 130
DdeI CTNAG 1 cut(s) 250
DinI GGCGCC 1 cut(s) 337
DpnI GATC 2 cut(s) 29, 38
DpnII GATC 2 cut(s) 27, 36
Eco130I CCWWGG 1 cut(s) 151
Eco57I CTGAAG 1 cut(s) 59
EcoT14I CCWWGG 1 cut(s) 151
EgeI GGCGCC 1 cut(s) 337
EheI GGCGCC 1 cut(s) 337
ErhI CCWWGG 1 cut(s) 151
FaiI YATR 4 cut(s) 146, 148, 204, 261
FauI CCCGC 1 cut(s) 121
FauNDI CATATG 1 cut(s) 146
Fnu4HI GCNGC 2 cut(s) 82, 395
Fsp4HI GCNGC 2 cut(s) 82, 395
FspBI CTAG 1 cut(s) 285
GlaI GCGC 2 cut(s) 80, 337
GluI GCNGC 2 cut(s) 82, 395
GsaI CCCAGC 1 cut(s) 412
HaeII RGCGCY 2 cut(s) 82, 339
HaeIII GGCC 2 cut(s) 243, 248
HapII CCGG 4 cut(s) 95, 162, 244, 312
HgaI GACGC 1 cut(s) 130
HhaI GCGC 2 cut(s) 81, 338
Hin1I GRCGYC 1 cut(s) 336
Hin6I GCGC 2 cut(s) 79, 336
HinP1I GCGC 2 cut(s) 79, 336
HincII GTYRAC 2 cut(s) 63, 127
HindII GTYRAC 2 cut(s) 63, 127
HinfI GANTC 2 cut(s) 315, 385
HpaII CCGG 4 cut(s) 95, 162, 244, 312
HphI GGTGA 1 cut(s) 151
Hpy166II GTNNAC 2 cut(s) 63, 127
Hpy188III TCNNGA 2 cut(s) 312, 371
Hpy8I GTNNAC 2 cut(s) 63, 127
HpyAV CCTTC 2 cut(s) 415, 421
HpyCH4IV ACGT 2 cut(s) 65, 271
HpyF10VI GCNNNNNNNGC 3 cut(s) 147, 162, 171
HpyF3I CTNAG 1 cut(s) 250
HpySE526I ACGT 2 cut(s) 65, 271
Hsp92I GRCGYC 1 cut(s) 336
HspAI GCGC 2 cut(s) 79, 336
KasI GGCGCC 1 cut(s) 335
Kpn2I TCCGGA 1 cut(s) 311
Kzo9I GATC 2 cut(s) 27, 36
LmnI GCTCC 1 cut(s) 314
LpnPI CCDG 9 cut(s) 108, 175, 225, 257, 318, 325, 355, 394, 402
Lsp1109I GCAGC 1 cut(s) 381
LweI GCATC 2 cut(s) 50, 165
MaeI CTAG 1 cut(s) 285
MaeII ACGT 2 cut(s) 65, 271
MalI GATC 2 cut(s) 29, 38
MboI GATC 2 cut(s) 27, 36
MboII GAAGA 1 cut(s) 112
MluCI AATT 4 cut(s) 264, 276, 319, 327
Mly113I GGCGCC 1 cut(s) 336
MroI TCCGGA 1 cut(s) 311
MslI CAYNNNNRTG 1 cut(s) 212
MspA1I CMGCKG 1 cut(s) 116
MspI CCGG 4 cut(s) 95, 162, 244, 312
MspR9I CCNGG 2 cut(s) 95, 245
Mva1269I GAATGC 1 cut(s) 231
MvnI CGCG 2 cut(s) 46, 141
MwoI GCNNNNNNNGC 3 cut(s) 147, 162, 171
NarI GGCGCC 1 cut(s) 336
NciI CCSGG 2 cut(s) 95, 245
NdeI CATATG 1 cut(s) 146
NdeII GATC 2 cut(s) 27, 36
NlaIV GGNNCC 2 cut(s) 208, 337
PctI GAATGC 1 cut(s) 231
PfeI GAWTC 2 cut(s) 315, 385
PkrI GCNGC 2 cut(s) 83, 396
Ple19I CGATCG 1 cut(s) 39
PluTI GGCGCC 1 cut(s) 339
Ppu21I YACGTR 1 cut(s) 272
PspFI CCCAGC 1 cut(s) 408
PspN4I GGNNCC 2 cut(s) 208, 337
PspPI GGNCC 1 cut(s) 246
PvuI CGATCG 1 cut(s) 39
RseI CAYNNNNRTG 1 cut(s) 212
SatI GCNGC 2 cut(s) 82, 395
Sau3AI GATC 2 cut(s) 27, 36
Sau96I GGNCC 1 cut(s) 246
ScrFI CCNGG 2 cut(s) 95, 245
SetI ASST 4 cut(s) 27, 68, 274, 311
SfaNI GCATC 2 cut(s) 50, 165
SfoI GGCGCC 1 cut(s) 337
SmiMI CAYNNNNRTG 1 cut(s) 212
Sse9I AATT 4 cut(s) 264, 276, 319, 327
SsiI CCGC 3 cut(s) 82, 107, 114
SspDI GGCGCC 1 cut(s) 335
SspMI CTAG 1 cut(s) 285
StyD4I CCNGG 2 cut(s) 93, 243
StyI CCWWGG 1 cut(s) 151
TaiI ACGT 2 cut(s) 68, 274
TaqI TCGA 2 cut(s) 35, 198
TasI AATT 4 cut(s) 264, 276, 319, 327
TauI GCSGC 1 cut(s) 84
TfiI GAWTC 2 cut(s) 315, 385
TseI GCWGC 1 cut(s) 394
TspGWI ACGGA 1 cut(s) 48
XapI RAATTY 2 cut(s) 264, 276
XspI CTAG 1 cut(s) 285
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.