pycom11g01550

transfer

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr11
N/A
Physical Location & Seq
Reverse (-)
1361516 .. 1362887
1372 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 363 bp
ATGAAGGACCAAAGTAGTGCTTCGAGATCGATCCTCGTCAGAGTGAAGCGTTCACTTGAGATGCTTAAGATAATATTCGAGCAAACTCTGGCCTCAAGCGGAAATTCAATCATGGATGCGGTTAACACAGCATATAAACAAGTTTTTTACGCCTACCACGGATGGGCTATGAGAAAGGCTGTTGCGGGTGCACTGTACACCCTTCCTACAAAGTCACTGTTCTTGAAAAGGCTAAAATTAGATGAGGCATCGGCTTTTGTTTTGATGCAAAGGACAGTTACTGCATTAGCTCCTCTGATACGCTACATCGACAACTTATTCCATTCAAGGGAGTCAGCTCAAGAACTGCTACACTTGATTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
GLTP

Protein Analysis

121

Amino Acids

13.61

Weight (kDa)

9.92

Isoelectric Point (pI)

39.16

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
GLTP PF08718 4 - 79 4.2e-17 Glycolipid transfer protein (GLTP)
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 3 cut(s) 99, 119, 185
AclWI GGATC 1 cut(s) 25
AcsI RAATTY 1 cut(s) 103
AfaI GTAC 1 cut(s) 197
AfiI CCNNNNNNNGG 2 cut(s) 163, 328
AflII CTTAAG 1 cut(s) 65
AgsI TTSAA 3 cut(s) 108, 226, 327
AluBI AGCT 2 cut(s) 290, 338
AluI AGCT 2 cut(s) 290, 338
Alw21I GWGCWC 1 cut(s) 193
Alw44I GTGCAC 1 cut(s) 189
AlwI GGATC 1 cut(s) 25
AlwNI CAGNNNCTG 1 cut(s) 281
AoxI GGCC 1 cut(s) 90
ApaLI GTGCAC 1 cut(s) 189
ApoI RAATTY 1 cut(s) 103
AspS9I GGNCC 1 cut(s) 7
AvaII GGWCC 1 cut(s) 7
BaeGI GKGCMC 1 cut(s) 193
Bbv12I GWGCWC 1 cut(s) 193
BccI CCATC 1 cut(s) 156
BfrI CTTAAG 1 cut(s) 65
Bme18I GGWCC 1 cut(s) 7
BmgT120I GGNCC 1 cut(s) 7
BmsI GCATC 4 cut(s) 51, 106, 255, 257
BpuEI CTTGAG 3 cut(s) 77, 79, 324
Bsa29I ATCGAT 1 cut(s) 29
BsaJI CCNNGG 1 cut(s) 157
Bsc4I CCNNNNNNNGG 2 cut(s) 163, 328
BseCI ATCGAT 1 cut(s) 29
BseDI CCNNGG 1 cut(s) 157
BseGI GGATG 2 cut(s) 121, 167
BseLI CCNNNNNNNGG 2 cut(s) 163, 328
BseRI GAGGAG 1 cut(s) 282
BseSI GKGCMC 1 cut(s) 193
BshFI GGCC 1 cut(s) 92
BshVI ATCGAT 1 cut(s) 29
BsiHKAI GWGCWC 1 cut(s) 193
BslI CCNNNNNNNGG 2 cut(s) 163, 328
BsnI GGCC 1 cut(s) 92
Bsp1286I GDGCHC 1 cut(s) 193
Bsp1407I TGTACA 1 cut(s) 195
Bsp143I GATC 2 cut(s) 26, 30
BspACI CCGC 3 cut(s) 99, 119, 185
BspANI GGCC 1 cut(s) 92
BspDI ATCGAT 1 cut(s) 29
BspPI GGATC 1 cut(s) 25
BspTI CTTAAG 1 cut(s) 65
BsrGI TGTACA 1 cut(s) 195
BssECI CCNNGG 1 cut(s) 157
BssMI GATC 2 cut(s) 26, 30
Bst4CI ACNGT 3 cut(s) 195, 219, 277
BstAFI CTTAAG 1 cut(s) 65
BstAUI TGTACA 1 cut(s) 195
BstDSI CCRYGG 1 cut(s) 157
BstF5I GGATG 2 cut(s) 121, 167
BstKTI GATC 2 cut(s) 29, 33
BstMBI GATC 2 cut(s) 26, 30
BstSLI GKGCMC 1 cut(s) 193
Bsu15I ATCGAT 1 cut(s) 29
BsuRI GGCC 1 cut(s) 92
BsuTUI ATCGAT 1 cut(s) 29
BtgI CCRYGG 1 cut(s) 157
BtsCI GGATG 2 cut(s) 121, 167
BtsIMutI CAGTG 2 cut(s) 191, 215
CaiI CAGNNNCTG 1 cut(s) 281
Cfr13I GGNCC 1 cut(s) 7
ClaI ATCGAT 1 cut(s) 29
Csp6I GTAC 1 cut(s) 196
CviAII CATG 1 cut(s) 112
CviJI RGCY 7 cut(s) 92, 167, 179, 232, 254, 290, 338
CviKI_1 RGCY 7 cut(s) 92, 167, 179, 232, 254, 290, 338
CviQI GTAC 1 cut(s) 196
DpnI GATC 2 cut(s) 28, 32
DpnII GATC 2 cut(s) 26, 30
Eco47I GGWCC 1 cut(s) 7
FaeI CATG 1 cut(s) 115
FaiI YATR 4 cut(s) 113, 133, 135, 170
FalI AAGNNNNNCTT 1 cut(s) 36
FatI CATG 1 cut(s) 111
FauI CCCGC 1 cut(s) 178
FokI GGATG 2 cut(s) 128, 174
HaeIII GGCC 1 cut(s) 92
Hin1II CATG 1 cut(s) 115
HincII GTYRAC 1 cut(s) 124
HindII GTYRAC 1 cut(s) 124
HinfI GANTC 1 cut(s) 332
HpaI GTTAAC 1 cut(s) 124
Hpy166II GTNNAC 4 cut(s) 53, 124, 191, 198
Hpy188I TCNGA 2 cut(s) 41, 297
Hpy188III TCNNGA 3 cut(s) 24, 223, 341
Hpy8I GTNNAC 4 cut(s) 53, 124, 191, 198
HpyAV CCTTC 1 cut(s) 212
HpyCH4III ACNGT 3 cut(s) 195, 219, 277
HpyCH4V TGCA 3 cut(s) 191, 268, 284
Hsp92II CATG 1 cut(s) 115
KspAI GTTAAC 1 cut(s) 124
Kzo9I GATC 2 cut(s) 26, 30
LmnI GCTCC 1 cut(s) 295
LpnPI CCDG 1 cut(s) 74
LweI GCATC 4 cut(s) 51, 106, 255, 257
MaeIII GTNAC 2 cut(s) 213, 277
MalI GATC 2 cut(s) 28, 32
MboI GATC 2 cut(s) 26, 30
MhlI GDGCHC 1 cut(s) 193
MluCI AATT 2 cut(s) 103, 236
MlyI GAGTC 1 cut(s) 341
MnlI CCTC 4 cut(s) 44, 103, 238, 303
MseI TTAA 2 cut(s) 66, 123
MspCI CTTAAG 1 cut(s) 65
NdeII GATC 2 cut(s) 26, 30
NlaIII CATG 1 cut(s) 115
NmuCI GTSAC 1 cut(s) 213
PleI GAGTC 1 cut(s) 340
PpsI GAGTC 1 cut(s) 340
PspPI GGNCC 1 cut(s) 7
PstNI CAGNNNCTG 1 cut(s) 281
RsaI GTAC 1 cut(s) 197
RsaNI GTAC 1 cut(s) 196
SaqAI TTAA 2 cut(s) 66, 123
Sau3AI GATC 2 cut(s) 26, 30
Sau96I GGNCC 1 cut(s) 7
SchI GAGTC 1 cut(s) 341
SduI GDGCHC 1 cut(s) 193
SetI ASST 2 cut(s) 292, 340
SfaNI GCATC 4 cut(s) 51, 106, 255, 257
SinI GGWCC 1 cut(s) 7
SmlI CTYRAG 4 cut(s) 56, 65, 94, 339
SmoI CTYRAG 4 cut(s) 56, 65, 94, 339
Sse9I AATT 2 cut(s) 103, 236
SsiI CCGC 3 cut(s) 99, 119, 185
SspI AATATT 1 cut(s) 75
TaaI ACNGT 3 cut(s) 195, 219, 277
TaqI TCGA 4 cut(s) 23, 29, 78, 309
TasI AATT 2 cut(s) 103, 236
TatI WGTACW 1 cut(s) 195
Tru1I TTAA 2 cut(s) 66, 123
Tru9I TTAA 2 cut(s) 66, 123
TscAI CASTG 2 cut(s) 198, 222
TseFI GTSAC 1 cut(s) 213
Tsp45I GTSAC 1 cut(s) 213
TspDTI ATGAA 1 cut(s) 17
TspGWI ACGGA 1 cut(s) 174
TspRI CASTG 2 cut(s) 198, 222
Vha464I CTTAAG 1 cut(s) 65
VneI GTGCAC 1 cut(s) 189
VpaK11BI GGWCC 1 cut(s) 7
XapI RAATTY 1 cut(s) 103
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.