pycom11g08570

This magnesium-dependent enzyme catalyzes the hydrolysis of ATP coupled with the transport of calcium

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr11
N/A
Physical Location & Seq
Reverse (-)
6649384 .. 6649939
556 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 201 bp
ATGATATATGATAACTGTTTTCTATGTTTGTTGTTGGTTAAAAACGTTATTTTCATTATTTTGGCTGCAAATGCTGCAGTAGGAGTGATTACGGAAACCAACGCAGAAAAAGCTCTTGAGGACAGAGTAGGACAGCGGAAATTAGATCGTATAGGACTAGGGGATAAAAAGAGTATGTTTTGTTGTTGCATGTTTCATTAA

Protein Analysis

67

Amino Acids

7.38

Weight (kDa)

7.61

Isoelectric Point (pI)

19.47

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 136
AclI AACGTT 1 cut(s) 45
AluBI AGCT 1 cut(s) 113
AluI AGCT 1 cut(s) 113
ApeKI GCWGC 2 cut(s) 65, 74
BbvI GCAGC 2 cut(s) 52, 61
BfaI CTAG 1 cut(s) 158
BfmI CTRYAG 1 cut(s) 75
BisI GCNGC 2 cut(s) 66, 75
BlsI GCNGC 2 cut(s) 67, 76
BpuEI CTTGAG 1 cut(s) 137
BseXI GCAGC 2 cut(s) 52, 61
Bsp143I GATC 1 cut(s) 145
BspACI CCGC 1 cut(s) 136
BspMAI CTGCAG 1 cut(s) 79
BssMI GATC 1 cut(s) 145
Bst4CI ACNGT 1 cut(s) 17
BstAPI GCANNNNNTGC 1 cut(s) 74
BstKTI GATC 1 cut(s) 148
BstMBI GATC 1 cut(s) 145
BstMWI GCNNNNNNNGC 3 cut(s) 71, 74, 110
BstNSI RCATGY 1 cut(s) 193
BstSFI CTRYAG 1 cut(s) 75
BstV1I GCAGC 2 cut(s) 52, 61
CviAII CATG 1 cut(s) 190
CviJI RGCY 2 cut(s) 65, 113
CviKI_1 RGCY 2 cut(s) 65, 113
DpnI GATC 1 cut(s) 147
DpnII GATC 1 cut(s) 145
FaeI CATG 1 cut(s) 193
FaiI YATR 6 cut(s) 7, 9, 25, 152, 176, 191
FatI CATG 1 cut(s) 189
Fnu4HI GCNGC 2 cut(s) 66, 75
Fsp4HI GCNGC 2 cut(s) 66, 75
FspBI CTAG 1 cut(s) 158
GluI GCNGC 2 cut(s) 66, 75
Hin1II CATG 1 cut(s) 193
Hpy188III TCNNGA 1 cut(s) 116
HpyCH4III ACNGT 1 cut(s) 17
HpyCH4IV ACGT 1 cut(s) 45
HpyCH4V TGCA 3 cut(s) 68, 77, 189
HpyF10VI GCNNNNNNNGC 3 cut(s) 71, 74, 110
HpySE526I ACGT 1 cut(s) 45
Hsp92II CATG 1 cut(s) 193
Kzo9I GATC 1 cut(s) 145
Lsp1109I GCAGC 2 cut(s) 52, 61
MaeI CTAG 1 cut(s) 158
MaeII ACGT 1 cut(s) 45
MalI GATC 1 cut(s) 147
MboI GATC 1 cut(s) 145
MluCI AATT 1 cut(s) 140
MnlI CCTC 1 cut(s) 112
MseI TTAA 2 cut(s) 39, 199
MspA1I CMGCKG 1 cut(s) 136
MwoI GCNNNNNNNGC 3 cut(s) 71, 74, 110
NdeII GATC 1 cut(s) 145
NlaIII CATG 1 cut(s) 193
NspI RCATGY 1 cut(s) 193
PkrI GCNGC 2 cut(s) 67, 76
Psp1406I AACGTT 1 cut(s) 45
PstI CTGCAG 1 cut(s) 79
SaqAI TTAA 2 cut(s) 39, 199
SatI GCNGC 2 cut(s) 66, 75
Sau3AI GATC 1 cut(s) 145
SetI ASST 2 cut(s) 48, 115
SfcI CTRYAG 1 cut(s) 75
SgeI CNNG 2 cut(s) 128, 170
SmlI CTYRAG 1 cut(s) 116
SmoI CTYRAG 1 cut(s) 116
Sse9I AATT 1 cut(s) 140
SsiI CCGC 1 cut(s) 136
SspMI CTAG 1 cut(s) 158
TaaI ACNGT 1 cut(s) 17
TaiI ACGT 1 cut(s) 48
TasI AATT 1 cut(s) 140
Tru1I TTAA 2 cut(s) 39, 199
Tru9I TTAA 2 cut(s) 39, 199
TseI GCWGC 2 cut(s) 65, 74
TspDTI ATGAA 2 cut(s) 43, 185
TspGWI ACGGA 1 cut(s) 107
XceI RCATGY 1 cut(s) 193
XspI CTAG 1 cut(s) 158
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.