pycom11g10680

Alpha/beta hydrolase family

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr11
N/A
Physical Location & Seq
Forward (+)
9095642 .. 9095956
315 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 315 bp
ATGAGTTTTCATTTTGTTCTCCAGGATAAAGCTCTGATGGAGGACCCAATCTACGAAGAATTCTGGCAAAGGGATGCAGAAGAATCAATTAGGCAGAGAATCTCGAAACCCTTCGTGGAGGAAGCTGTTTTGCAAGTGTCAAATTGGGGTTTCAGCCTTGCAGACCTCAAATTGCAGAAGAAAGAACAAGGGAAAGGCGTGCTCAATTGGATTAAGTCCATGCTCAGCTCAGCTCAGGAAGAATACATTGGCTTCTTTGGCCCAATACACATATGGCAGGTCAGAAGCATCTCCATCGTTTACATGTTTGTTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

105

Amino Acids

12.27

Weight (kDa)

5.33

Isoelectric Point (pI)

50.6

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 1 cut(s) 268
AcsI RAATTY 1 cut(s) 59
AflIII ACRYGT 1 cut(s) 303
AjnI CCWGG 1 cut(s) 21
AjuI GAANNNNNNNTTGG 2 cut(s) 231, 263
AluBI AGCT 4 cut(s) 32, 125, 228, 233
AluI AGCT 4 cut(s) 32, 125, 228, 233
Alw21I GWGCWC 1 cut(s) 204
AoxI GGCC 1 cut(s) 259
ApoI RAATTY 1 cut(s) 59
Asp700I GAANNNNTTC 1 cut(s) 110
AspS9I GGNCC 2 cut(s) 43, 260
AvaII GGWCC 1 cut(s) 43
Bbv12I GWGCWC 1 cut(s) 204
BccI CCATC 2 cut(s) 31, 302
BcgI CGANNNNNNTGC 2 cut(s) 277, 311
BciT130I CCWGG 1 cut(s) 23
BfuAI ACCTGC 1 cut(s) 268
BlpI GCTNAGC 2 cut(s) 224, 229
Bme1390I CCNGG 1 cut(s) 23
Bme18I GGWCC 1 cut(s) 43
BmgT120I GGNCC 2 cut(s) 43, 260
BmiI GGNNCC 1 cut(s) 45
BmrFI CCNGG 1 cut(s) 23
BmsI GCATC 2 cut(s) 64, 297
BpmI CTGGAG 1 cut(s) 5
Bpu10I CCTNAGC 1 cut(s) 234
Bpu1102I GCTNAGC 2 cut(s) 224, 229
BseBI CCWGG 1 cut(s) 23
BseGI GGATG 1 cut(s) 79
BseMII CTCAG 3 cut(s) 238, 243, 248
BshFI GGCC 1 cut(s) 261
BsiHKAI GWGCWC 1 cut(s) 204
BsnI GGCC 1 cut(s) 261
Bsp1286I GDGCHC 1 cut(s) 204
Bsp1720I GCTNAGC 2 cut(s) 224, 229
BspANI GGCC 1 cut(s) 261
BspCNI CTCAG 3 cut(s) 237, 242, 247
BspLI GGNNCC 1 cut(s) 45
BspMI ACCTGC 1 cut(s) 268
Bst2UI CCWGG 1 cut(s) 23
BstC8I GCNNGC 1 cut(s) 200
BstDEI CTNAG 3 cut(s) 224, 229, 234
BstF5I GGATG 1 cut(s) 79
BstMWI GCNNNNNNNGC 1 cut(s) 258
BstNI CCWGG 1 cut(s) 23
BstNSI RCATGY 1 cut(s) 307
BstSCI CCNGG 1 cut(s) 21
BsuRI GGCC 1 cut(s) 261
BtsCI GGATG 1 cut(s) 79
BveI ACCTGC 1 cut(s) 268
Cac8I GCNNGC 1 cut(s) 200
Cfr13I GGNCC 2 cut(s) 43, 260
CviAII CATG 2 cut(s) 220, 304
CviJI RGCY 7 cut(s) 32, 125, 156, 228, 233, 252, 261
CviKI_1 RGCY 7 cut(s) 32, 125, 156, 228, 233, 252, 261
DdeI CTNAG 3 cut(s) 224, 229, 234
Eco47I GGWCC 1 cut(s) 43
EcoO109I RGGNCCY 1 cut(s) 43
EcoRI GAATTC 1 cut(s) 59
EcoRII CCWGG 1 cut(s) 21
FaeI CATG 2 cut(s) 223, 307
FaiI YATR 4 cut(s) 221, 272, 274, 305
FatI CATG 2 cut(s) 219, 303
FauNDI CATATG 1 cut(s) 272
FokI GGATG 1 cut(s) 86
GsuI CTGGAG 1 cut(s) 5
HaeIII GGCC 1 cut(s) 261
Hin1II CATG 2 cut(s) 223, 307
HinfI GANTC 2 cut(s) 83, 99
Hpy166II GTNNAC 1 cut(s) 301
Hpy188I TCNGA 2 cut(s) 36, 284
Hpy188III TCNNGA 2 cut(s) 103, 236
Hpy8I GTNNAC 1 cut(s) 301
HpyAV CCTTC 1 cut(s) 121
HpyCH4V TGCA 4 cut(s) 77, 133, 161, 175
HpyF10VI GCNNNNNNNGC 1 cut(s) 258
HpyF3I CTNAG 3 cut(s) 224, 229, 234
Hsp92II CATG 2 cut(s) 223, 307
LpnPI CCDG 5 cut(s) 8, 35, 49, 221, 263
LweI GCATC 2 cut(s) 64, 297
MboII GAAGA 4 cut(s) 68, 92, 190, 251
MfeI CAATTG 1 cut(s) 205
MhlI GDGCHC 1 cut(s) 204
MluCI AATT 5 cut(s) 59, 87, 142, 170, 205
MnlI CCTC 3 cut(s) 34, 112, 176
MroXI GAANNNNTTC 1 cut(s) 110
MseI TTAA 1 cut(s) 213
MspR9I CCNGG 1 cut(s) 23
MunI CAATTG 1 cut(s) 205
MvaI CCWGG 1 cut(s) 23
MwoI GCNNNNNNNGC 1 cut(s) 258
NdeI CATATG 1 cut(s) 272
NlaIII CATG 2 cut(s) 223, 307
NlaIV GGNNCC 1 cut(s) 45
NspI RCATGY 1 cut(s) 307
PciI ACATGT 1 cut(s) 303
PdmI GAANNNNTTC 1 cut(s) 110
PfeI GAWTC 2 cut(s) 83, 99
PfoI TCCNGGA 1 cut(s) 21
PpuMI RGGWCCY 1 cut(s) 43
PscI ACATGT 1 cut(s) 303
Psp5II RGGWCCY 1 cut(s) 43
Psp6I CCWGG 1 cut(s) 21
PspGI CCWGG 1 cut(s) 21
PspN4I GGNNCC 1 cut(s) 45
PspPI GGNCC 2 cut(s) 43, 260
PspPPI RGGWCCY 1 cut(s) 43
SaqAI TTAA 1 cut(s) 213
Sau96I GGNCC 2 cut(s) 43, 260
ScrFI CCNGG 1 cut(s) 23
SduI GDGCHC 1 cut(s) 204
SetI ASST 6 cut(s) 34, 127, 168, 230, 235, 282
SfaNI GCATC 2 cut(s) 64, 297
SinI GGWCC 1 cut(s) 43
Sse9I AATT 5 cut(s) 59, 87, 142, 170, 205
StyD4I CCNGG 1 cut(s) 21
TaqI TCGA 1 cut(s) 104
TasI AATT 5 cut(s) 59, 87, 142, 170, 205
TfiI GAWTC 2 cut(s) 83, 99
Tru1I TTAA 1 cut(s) 213
Tru9I TTAA 1 cut(s) 213
VpaK11BI GGWCC 1 cut(s) 43
XapI RAATTY 1 cut(s) 59
XceI RCATGY 1 cut(s) 307
XcmI CCANNNNNNNNNTGG 1 cut(s) 270
XmnI GAANNNNTTC 1 cut(s) 110
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.