pycom11g12320

gag-polypeptide of LTR copia-type

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr11
N/A
Physical Location & Seq
Reverse (-)
11239748 .. 11240188
441 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 216 bp
ATGTCTAACGATCATATACACACTTTGTATTTCAAAAACAAAAATCAAACTCTAACATGGCCTCAGAGCCATGTTCAATCGTCTAAACTTAGGTTGGATCGAGTAGAGCTGAGCTTTCGCGTGCCAATTTTCAGTGGTGAAAACTATGAGTTCCGAAGAATCCATATGAGGACTATACTTAAGTCCAATGGACTCTTGGCTTTCATTGAAAAATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.

Protein Analysis

72

Amino Acids

8.52

Weight (kDa)

10.11

Isoelectric Point (pI)

54.13

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccII CGCG 1 cut(s) 120
AclWI GGATC 1 cut(s) 105
AflII CTTAAG 1 cut(s) 179
AgsI TTSAA 3 cut(s) 34, 77, 209
AluBI AGCT 2 cut(s) 109, 114
AluI AGCT 2 cut(s) 109, 114
AlwI GGATC 1 cut(s) 105
AoxI GGCC 1 cut(s) 59
AsuHPI GGTGA 1 cut(s) 149
BfrI CTTAAG 1 cut(s) 179
BlpI GCTNAGC 1 cut(s) 110
Bpu1102I GCTNAGC 1 cut(s) 110
BseMII CTCAG 2 cut(s) 77, 101
Bsh1236I CGCG 1 cut(s) 120
BshFI GGCC 1 cut(s) 61
BsnI GGCC 1 cut(s) 61
Bsp143I GATC 2 cut(s) 10, 97
Bsp1720I GCTNAGC 1 cut(s) 110
BspANI GGCC 1 cut(s) 61
BspCNI CTCAG 2 cut(s) 76, 102
BspFNI CGCG 1 cut(s) 120
BspPI GGATC 1 cut(s) 105
BspTI CTTAAG 1 cut(s) 179
BssMI GATC 2 cut(s) 10, 97
BstAFI CTTAAG 1 cut(s) 179
BstC8I GCNNGC 1 cut(s) 122
BstDEI CTNAG 3 cut(s) 63, 89, 110
BstFNI CGCG 1 cut(s) 120
BstKTI GATC 2 cut(s) 13, 100
BstMBI GATC 2 cut(s) 10, 97
BstUI CGCG 1 cut(s) 120
BsuRI GGCC 1 cut(s) 61
BtsIMutI CAGTG 1 cut(s) 139
Cac8I GCNNGC 1 cut(s) 122
CviAII CATG 2 cut(s) 57, 71
CviJI RGCY 5 cut(s) 61, 69, 109, 114, 200
CviKI_1 RGCY 5 cut(s) 61, 69, 109, 114, 200
DdeI CTNAG 3 cut(s) 63, 89, 110
DpnI GATC 2 cut(s) 12, 99
DpnII GATC 2 cut(s) 10, 97
FaeI CATG 2 cut(s) 60, 74
FaiI YATR 8 cut(s) 15, 17, 58, 72, 147, 165, 167, 176
FatI CATG 2 cut(s) 56, 70
FauNDI CATATG 1 cut(s) 165
HaeIII GGCC 1 cut(s) 61
Hin1II CATG 2 cut(s) 60, 74
HinfI GANTC 2 cut(s) 159, 192
HphI GGTGA 1 cut(s) 149
Hpy188I TCNGA 2 cut(s) 66, 155
HpyF3I CTNAG 3 cut(s) 63, 89, 110
Hsp92II CATG 2 cut(s) 60, 74
Kzo9I GATC 2 cut(s) 10, 97
MalI GATC 2 cut(s) 12, 99
MboI GATC 2 cut(s) 10, 97
MboII GAAGA 1 cut(s) 168
MluCI AATT 1 cut(s) 126
MlyI GAGTC 1 cut(s) 186
MmeI TCCRAC 1 cut(s) 75
MnlI CCTC 2 cut(s) 72, 162
MseI TTAA 1 cut(s) 180
MspCI CTTAAG 1 cut(s) 179
MvnI CGCG 1 cut(s) 120
NdeI CATATG 1 cut(s) 165
NdeII GATC 2 cut(s) 10, 97
NlaIII CATG 2 cut(s) 60, 74
PfeI GAWTC 1 cut(s) 159
PleI GAGTC 1 cut(s) 186
PpsI GAGTC 1 cut(s) 186
SaqAI TTAA 1 cut(s) 180
Sau3AI GATC 2 cut(s) 10, 97
SchI GAGTC 1 cut(s) 186
SetI ASST 3 cut(s) 95, 111, 116
SgeI CNNG 6 cut(s) 69, 83, 113, 131, 133, 208
SmlI CTYRAG 1 cut(s) 179
SmoI CTYRAG 1 cut(s) 179
Sse9I AATT 1 cut(s) 126
TaqI TCGA 1 cut(s) 100
TasI AATT 1 cut(s) 126
TfiI GAWTC 1 cut(s) 159
Tru1I TTAA 1 cut(s) 180
Tru9I TTAA 1 cut(s) 180
TscAI CASTG 1 cut(s) 139
TspDTI ATGAA 1 cut(s) 193
TspRI CASTG 1 cut(s) 139
Vha464I CTTAAG 1 cut(s) 179
XcmI CCANNNNNNNNNTGG 1 cut(s) 193
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.