pycom11g13810

ribonuclease H protein

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr11
N/A
Physical Location & Seq
Reverse (-)
13621521 .. 13621937
417 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 363 bp
ATGGGCTTTGAAAAAGTATTTTGCCCTAGAGTGGATAAGGTTATTAAAGAATTGAACAATGTCTTGCTCCGCCAGATAGGAATGGCAGCAGAAAGCATAAGGATCGTAGGTCAATACATACAGTTAAGCCTTAGGCAATGGAATAAAGCCTACATTCTCAAGCAAGTTTGGCTATTGGCCTACAACCCTAGTTCCATATGGATCGACTGGATCAAAGCTAGATATATCAAATCCAAATTGATATGGGACTTTTTCCTTCCAACTGGCTGTTCTCCTGTGTGGAAGAATATATGCAAGTTGATCCCCAAAGCAAAGCTATTCATTTTACATGTCATTGGTGAAGGATTGATCACTAAATTCTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
Pfam Domains
Protein Families

Protein Analysis

121

Amino Acids

14.07

Weight (kDa)

9.88

Isoelectric Point (pI)

28.83

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 70
AclWI GGATC 4 cut(s) 110, 209, 218, 295
AcsI RAATTY 1 cut(s) 356
AfiI CCNNNNNNNGG 1 cut(s) 31
AflIII ACRYGT 1 cut(s) 328
AgsI TTSAA 2 cut(s) 11, 55
AjuI GAANNNNNNNTTGG 2 cut(s) 253, 285
AluBI AGCT 2 cut(s) 218, 316
AluI AGCT 2 cut(s) 218, 316
AlwI GGATC 4 cut(s) 110, 209, 218, 295
AoxI GGCC 1 cut(s) 177
ApeKI GCWGC 1 cut(s) 86
ApoI RAATTY 1 cut(s) 356
AsuHPI GGTGA 1 cut(s) 350
AxyI CCTNAGG 1 cut(s) 131
BbvI GCAGC 1 cut(s) 98
BcgI CGANNNNNNTGC 2 cut(s) 85, 119
BclI TGATCA 1 cut(s) 348
BfaI CTAG 4 cut(s) 27, 189, 219, 361
BisI GCNGC 1 cut(s) 87
BlsI GCNGC 1 cut(s) 88
BpuEI CTTGAG 1 cut(s) 143
Bsc4I CCNNNNNNNGG 1 cut(s) 31
Bse1I ACTGG 2 cut(s) 212, 268
Bse21I CCTNAGG 1 cut(s) 131
Bse3DI GCAATG 1 cut(s) 143
BseLI CCNNNNNNNGG 1 cut(s) 31
BseMI GCAATG 1 cut(s) 143
BseNI ACTGG 2 cut(s) 212, 268
BseXI GCAGC 1 cut(s) 98
BshFI GGCC 1 cut(s) 179
BslFI GGGAC 1 cut(s) 260
BslI CCNNNNNNNGG 1 cut(s) 31
BsmFI GGGAC 1 cut(s) 260
BsnI GGCC 1 cut(s) 179
Bsp143I GATC 5 cut(s) 102, 201, 210, 300, 348
BspACI CCGC 1 cut(s) 70
BspANI GGCC 1 cut(s) 179
BspPI GGATC 4 cut(s) 110, 209, 218, 295
BsrDI GCAATG 1 cut(s) 143
BsrI ACTGG 2 cut(s) 212, 268
BssMI GATC 5 cut(s) 102, 201, 210, 300, 348
Bst4CI ACNGT 1 cut(s) 123
BstDEI CTNAG 1 cut(s) 131
BstKTI GATC 5 cut(s) 105, 204, 213, 303, 351
BstMBI GATC 5 cut(s) 102, 201, 210, 300, 348
BstMWI GCNNNNNNNGC 1 cut(s) 169
BstNSI RCATGY 1 cut(s) 332
BstV1I GCAGC 1 cut(s) 98
Bsu36I CCTNAGG 1 cut(s) 131
BsuRI GGCC 1 cut(s) 179
CviAII CATG 1 cut(s) 329
CviJI RGCY 8 cut(s) 6, 129, 149, 172, 179, 218, 267, 316
CviKI_1 RGCY 8 cut(s) 6, 129, 149, 172, 179, 218, 267, 316
DdeI CTNAG 1 cut(s) 131
DpnI GATC 5 cut(s) 104, 203, 212, 302, 350
DpnII GATC 5 cut(s) 102, 201, 210, 300, 348
EciI GGCGGA 1 cut(s) 59
Eco81I CCTNAGG 1 cut(s) 131
FaeI CATG 1 cut(s) 332
FaiI YATR 9 cut(s) 98, 119, 197, 199, 225, 244, 290, 292, 330
FaqI GGGAC 1 cut(s) 260
FatI CATG 1 cut(s) 328
FauNDI CATATG 1 cut(s) 197
FbaI TGATCA 1 cut(s) 348
Fnu4HI GCNGC 1 cut(s) 87
Fsp4HI GCNGC 1 cut(s) 87
FspBI CTAG 4 cut(s) 27, 189, 219, 361
GluI GCNGC 1 cut(s) 87
HaeIII GGCC 1 cut(s) 179
Hin1II CATG 1 cut(s) 332
HphI GGTGA 1 cut(s) 350
HpyAV CCTTC 2 cut(s) 266, 335
HpyCH4III ACNGT 1 cut(s) 123
HpyCH4V TGCA 1 cut(s) 294
HpyF10VI GCNNNNNNNGC 1 cut(s) 169
HpyF3I CTNAG 1 cut(s) 131
Hsp92II CATG 1 cut(s) 332
Ksp22I TGATCA 1 cut(s) 348
Kzo9I GATC 5 cut(s) 102, 201, 210, 300, 348
LmnI GCTCC 1 cut(s) 72
LpnPI CCDG 4 cut(s) 86, 193, 249, 288
Lsp1109I GCAGC 1 cut(s) 98
MaeI CTAG 4 cut(s) 27, 189, 219, 361
MalI GATC 5 cut(s) 104, 203, 212, 302, 350
MboI GATC 5 cut(s) 102, 201, 210, 300, 348
MboII GAAGA 1 cut(s) 295
MluCI AATT 3 cut(s) 50, 236, 356
MmeI TCCRAC 1 cut(s) 284
MseI TTAA 2 cut(s) 45, 125
MwoI GCNNNNNNNGC 1 cut(s) 169
NdeI CATATG 1 cut(s) 197
NdeII GATC 5 cut(s) 102, 201, 210, 300, 348
NlaIII CATG 1 cut(s) 332
NspI RCATGY 1 cut(s) 332
PciI ACATGT 1 cut(s) 328
PkrI GCNGC 1 cut(s) 88
PscI ACATGT 1 cut(s) 328
SaqAI TTAA 2 cut(s) 45, 125
SatI GCNGC 1 cut(s) 87
Sau3AI GATC 5 cut(s) 102, 201, 210, 300, 348
SetI ASST 4 cut(s) 42, 112, 220, 318
SmlI CTYRAG 1 cut(s) 158
SmoI CTYRAG 1 cut(s) 158
Sse9I AATT 3 cut(s) 50, 236, 356
SsiI CCGC 1 cut(s) 70
SspMI CTAG 4 cut(s) 27, 189, 219, 361
TaaI ACNGT 1 cut(s) 123
TaqI TCGA 1 cut(s) 204
TasI AATT 3 cut(s) 50, 236, 356
Tru1I TTAA 2 cut(s) 45, 125
Tru9I TTAA 2 cut(s) 45, 125
TseI GCWGC 1 cut(s) 86
TspDTI ATGAA 1 cut(s) 310
XapI RAATTY 1 cut(s) 356
XceI RCATGY 1 cut(s) 332
XspI CTAG 4 cut(s) 27, 189, 219, 361
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.