pycom11g13870

Pentatricopeptide repeat-containing protein

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr11
N/A
Physical Location & Seq
Forward (+)
13697016 .. 13697606
591 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 417 bp
ATGGAGATTCGTTTAACAAAGGAGGAGCACGGATACTTCTGTTTGACCCCATATCCCATATCCCGTATCCGATACTTGATCGGATACTATACTTGTCCGATACTTTCAGATACTCATTCGACACATATCCTGGTTGATGGACACGAATTGGACATAATGGATATGCATATTTTACATTTAAGATACACGTATTCAGCTTTTATGATACATTTACGCTTTCAGAAAAGTTTGAACTTTTCTTCTCTAACAACTCAAATGTACTTGAATTTGAATGATGAATTATGTTTTAAAATGTATATTTTGTTACTATATACATTTTTATTTGCCGTATCCATAATGTATCGTATCTTAATTTTTAAAGATTTTCCGTATAACCTTAAAAAACAAAGTATGAAAGGTTCGAAAACAATTGACTAA

Protein Analysis

139

Amino Acids

16.56

Weight (kDa)

8.39

Isoelectric Point (pI)

42.48

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 265
AfaI GTAC 1 cut(s) 260
AflIII ACRYGT 1 cut(s) 186
AgsI TTSAA 3 cut(s) 232, 265, 271
AjnI CCWGG 1 cut(s) 129
AluBI AGCT 1 cut(s) 197
AluI AGCT 1 cut(s) 197
Alw21I GWGCWC 1 cut(s) 30
ApoI RAATTY 1 cut(s) 265
AsuII TTCGAA 1 cut(s) 401
BaeI ACNNNNGTAYC 2 cut(s) 25, 58
Bbv12I GWGCWC 1 cut(s) 30
BccI CCATC 1 cut(s) 131
BceAI ACGGC 1 cut(s) 311
BciT130I CCWGG 1 cut(s) 131
BciVI GTATCC 4 cut(s) 26, 77, 77, 340
BfuI GTATCC 4 cut(s) 26, 77, 77, 340
Bme1390I CCNGG 1 cut(s) 131
BmrFI CCNGG 1 cut(s) 131
Bpu14I TTCGAA 1 cut(s) 401
BsaAI YACGTR 1 cut(s) 189
BseBI CCWGG 1 cut(s) 131
BseRI GAGGAG 1 cut(s) 38
BsiHKAI GWGCWC 1 cut(s) 30
Bsp119I TTCGAA 1 cut(s) 401
Bsp1286I GDGCHC 1 cut(s) 30
Bsp143I GATC 1 cut(s) 78
BspT104I TTCGAA 1 cut(s) 401
BssMI GATC 1 cut(s) 78
Bst2UI CCWGG 1 cut(s) 131
BstBAI YACGTR 1 cut(s) 189
BstBI TTCGAA 1 cut(s) 401
BstKTI GATC 1 cut(s) 81
BstMBI GATC 1 cut(s) 78
BstNI CCWGG 1 cut(s) 131
BstSCI CCNGG 1 cut(s) 129
BsuI GTATCC 4 cut(s) 26, 77, 77, 340
Csp6I GTAC 1 cut(s) 259
CviJI RGCY 1 cut(s) 197
CviKI_1 RGCY 1 cut(s) 197
CviQI GTAC 1 cut(s) 259
DpnI GATC 1 cut(s) 80
DpnII GATC 1 cut(s) 78
DraI TTTAAA 2 cut(s) 289, 358
EcoRII CCWGG 1 cut(s) 129
EcoT22I ATGCAT 1 cut(s) 168
HinfI GANTC 1 cut(s) 7
Hpy188I TCNGA 5 cut(s) 71, 83, 99, 109, 222
HpyCH4IV ACGT 1 cut(s) 188
HpyCH4V TGCA 1 cut(s) 166
HpySE526I ACGT 1 cut(s) 188
Kzo9I GATC 1 cut(s) 78
LmnI GCTCC 1 cut(s) 25
LpnPI CCDG 2 cut(s) 116, 143
MaeII ACGT 1 cut(s) 188
MaeIII GTNAC 1 cut(s) 303
MalI GATC 1 cut(s) 80
MboI GATC 1 cut(s) 78
MboII GAAGA 1 cut(s) 231
MfeI CAATTG 1 cut(s) 408
MhlI GDGCHC 1 cut(s) 30
MluCI AATT 5 cut(s) 146, 265, 278, 351, 408
MnlI CCTC 1 cut(s) 16
Mph1103I ATGCAT 1 cut(s) 168
MseI TTAA 6 cut(s) 14, 179, 288, 350, 357, 378
MspR9I CCNGG 1 cut(s) 131
MunI CAATTG 1 cut(s) 408
MvaI CCWGG 1 cut(s) 131
NdeII GATC 1 cut(s) 78
NsiI ATGCAT 1 cut(s) 168
NspV TTCGAA 1 cut(s) 401
PfeI GAWTC 1 cut(s) 7
Ppu21I YACGTR 1 cut(s) 189
Psp6I CCWGG 1 cut(s) 129
PspGI CCWGG 1 cut(s) 129
PsrI GAACNNNNNNTAC 2 cut(s) 382, 414
RsaI GTAC 1 cut(s) 260
RsaNI GTAC 1 cut(s) 259
SaqAI TTAA 6 cut(s) 14, 179, 288, 350, 357, 378
Sau3AI GATC 1 cut(s) 78
ScrFI CCNGG 1 cut(s) 131
SduI GDGCHC 1 cut(s) 30
SetI ASST 4 cut(s) 191, 199, 378, 400
SfuI TTCGAA 1 cut(s) 401
SgeI CNNG 9 cut(s) 41, 75, 88, 105, 142, 143, 155, 199, 274
Sse9I AATT 5 cut(s) 146, 265, 278, 351, 408
StyD4I CCNGG 1 cut(s) 129
TaiI ACGT 1 cut(s) 191
TaqI TCGA 2 cut(s) 119, 401
TasI AATT 5 cut(s) 146, 265, 278, 351, 408
TatI WGTACW 1 cut(s) 258
TfiI GAWTC 1 cut(s) 7
Tru1I TTAA 6 cut(s) 14, 179, 288, 350, 357, 378
Tru9I TTAA 6 cut(s) 14, 179, 288, 350, 357, 378
TspDTI ATGAA 2 cut(s) 291, 407
TspGWI ACGGA 2 cut(s) 45, 357
XapI RAATTY 1 cut(s) 265
Zsp2I ATGCAT 1 cut(s) 168
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.