pycom11g16090

anion transporter 6

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr11
N/A
Physical Location & Seq
Forward (+)
17451644 .. 17452704
1061 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 357 bp
ATGGACTATCGGTGGATAAGGTCCAACGGGCGGGTTCGGGTTCTGGGTCCGATTCTGAGGGGGGATAGAGTCAGGAAAGCGGGTCTGAGGAAGTGGGTTTTGATCGGGATTGGCCTCCGTGGAAGAACGTACCTCAGAGGTACAAGCTCATTGGGACTACTTCGCTTGCCTTTGTCATCTGCAACATGGATAAGAAAAGTTCTTGAGTTTGGAGTGTTAACTTGGTCTTTGGCTACGTCACTTGTCCCTCTTGTTGCTGGATTTACACCTGGTTTAGTTTTGTCAAGAATTTTGGTAGGAATTGGAGAAGGCATTTCCCCATCCGCCACAATAGACCTTTTTGCCAAGCATGTATGA

Protein Analysis

119

Amino Acids

12.93

Weight (kDa)

11.88

Isoelectric Point (pI)

29.71

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 3 cut(s) 31, 80, 324
AcsI RAATTY 1 cut(s) 288
AfaI GTAC 2 cut(s) 131, 142
AfiI CCNNNNNNNGG 1 cut(s) 30
AjnI CCWGG 1 cut(s) 268
AluBI AGCT 1 cut(s) 147
AluI AGCT 1 cut(s) 147
AoxI GGCC 1 cut(s) 112
ApoI RAATTY 1 cut(s) 288
AspS9I GGNCC 2 cut(s) 21, 47
AvaII GGWCC 2 cut(s) 21, 47
BccI CCATC 1 cut(s) 328
BciT130I CCWGG 1 cut(s) 270
Bme1390I CCNGG 1 cut(s) 270
Bme18I GGWCC 2 cut(s) 21, 47
BmgT120I GGNCC 2 cut(s) 21, 47
BmiI GGNNCC 1 cut(s) 48
BmrFI CCNGG 1 cut(s) 270
BpuEI CTTGAG 1 cut(s) 224
BsaJI CCNNGG 1 cut(s) 118
Bsc4I CCNNNNNNNGG 1 cut(s) 30
BseBI CCWGG 1 cut(s) 270
BseDI CCNNGG 1 cut(s) 118
BseGI GGATG 1 cut(s) 320
BseLI CCNNNNNNNGG 1 cut(s) 30
BseMII CTCAG 3 cut(s) 47, 77, 148
BshFI GGCC 1 cut(s) 114
BslFI GGGAC 2 cut(s) 168, 230
BslI CCNNNNNNNGG 1 cut(s) 30
BsmFI GGGAC 2 cut(s) 168, 230
BsnI GGCC 1 cut(s) 114
Bsp143I GATC 1 cut(s) 102
BspACI CCGC 3 cut(s) 31, 80, 324
BspANI GGCC 1 cut(s) 114
BspCNI CTCAG 3 cut(s) 48, 78, 147
BspLI GGNNCC 1 cut(s) 48
BssECI CCNNGG 1 cut(s) 118
BssMI GATC 1 cut(s) 102
Bst2UI CCWGG 1 cut(s) 270
BstC8I GCNNGC 1 cut(s) 167
BstDEI CTNAG 3 cut(s) 56, 86, 134
BstDSI CCRYGG 1 cut(s) 118
BstF5I GGATG 1 cut(s) 320
BstKTI GATC 1 cut(s) 105
BstMBI GATC 1 cut(s) 102
BstNI CCWGG 1 cut(s) 270
BstNSI RCATGY 1 cut(s) 353
BstSCI CCNGG 1 cut(s) 268
BsuRI GGCC 1 cut(s) 114
BtgI CCRYGG 1 cut(s) 118
BtsCI GGATG 1 cut(s) 320
Cac8I GCNNGC 1 cut(s) 167
Cfr13I GGNCC 2 cut(s) 21, 47
CsiI ACCWGGT 1 cut(s) 268
Csp6I GTAC 2 cut(s) 130, 141
CviAII CATG 2 cut(s) 186, 350
CviJI RGCY 3 cut(s) 114, 147, 233
CviKI_1 RGCY 3 cut(s) 114, 147, 233
CviQI GTAC 2 cut(s) 130, 141
DdeI CTNAG 3 cut(s) 56, 86, 134
DpnI GATC 1 cut(s) 104
DpnII GATC 1 cut(s) 102
EciI GGCGGA 1 cut(s) 313
Eco47I GGWCC 2 cut(s) 21, 47
EcoRII CCWGG 1 cut(s) 268
FaeI CATG 2 cut(s) 189, 353
FaiI YATR 3 cut(s) 187, 351, 355
FaqI GGGAC 2 cut(s) 168, 230
FatI CATG 2 cut(s) 185, 349
FauI CCCGC 2 cut(s) 24, 73
FokI GGATG 1 cut(s) 307
HaeIII GGCC 1 cut(s) 114
Hin1II CATG 2 cut(s) 189, 353
HincII GTYRAC 1 cut(s) 219
HindII GTYRAC 1 cut(s) 219
HinfI GANTC 2 cut(s) 52, 69
HpaI GTTAAC 1 cut(s) 219
Hpy166II GTNNAC 1 cut(s) 219
Hpy188I TCNGA 4 cut(s) 51, 57, 87, 137
Hpy188III TCNNGA 4 cut(s) 73, 106, 203, 285
Hpy8I GTNNAC 1 cut(s) 219
HpyAV CCTTC 1 cut(s) 302
HpyCH4IV ACGT 2 cut(s) 128, 236
HpyCH4V TGCA 1 cut(s) 182
HpyF3I CTNAG 3 cut(s) 56, 86, 134
HpySE526I ACGT 2 cut(s) 128, 236
Hsp92II CATG 2 cut(s) 189, 353
KspAI GTTAAC 1 cut(s) 219
Kzo9I GATC 1 cut(s) 102
LpnPI CCDG 5 cut(s) 29, 58, 243, 255, 282
MabI ACCWGGT 1 cut(s) 268
MaeII ACGT 2 cut(s) 128, 236
MaeIII GTNAC 1 cut(s) 237
MalI GATC 1 cut(s) 104
MboI GATC 1 cut(s) 102
MboII GAAGA 1 cut(s) 135
MluCI AATT 2 cut(s) 288, 300
MlyI GAGTC 1 cut(s) 78
MmeI TCCRAC 1 cut(s) 48
MnlI CCTC 6 cut(s) 51, 81, 125, 131, 143, 258
MseI TTAA 1 cut(s) 218
MspR9I CCNGG 1 cut(s) 270
MvaI CCWGG 1 cut(s) 270
NdeII GATC 1 cut(s) 102
NlaIII CATG 2 cut(s) 189, 353
NlaIV GGNNCC 1 cut(s) 48
NmuCI GTSAC 1 cut(s) 237
NspI RCATGY 1 cut(s) 353
PfeI GAWTC 1 cut(s) 52
PleI GAGTC 1 cut(s) 77
PpsI GAGTC 1 cut(s) 77
Psp6I CCWGG 1 cut(s) 268
PspGI CCWGG 1 cut(s) 268
PspN4I GGNNCC 1 cut(s) 48
PspPI GGNCC 2 cut(s) 21, 47
RsaI GTAC 2 cut(s) 131, 142
RsaNI GTAC 2 cut(s) 130, 141
SaqAI TTAA 1 cut(s) 218
Sau3AI GATC 1 cut(s) 102
Sau96I GGNCC 2 cut(s) 21, 47
SchI GAGTC 1 cut(s) 78
ScrFI CCNGG 1 cut(s) 270
SetI ASST 8 cut(s) 23, 131, 135, 142, 149, 239, 271, 339
SexAI ACCWGGT 1 cut(s) 268
SinI GGWCC 2 cut(s) 21, 47
SmlI CTYRAG 1 cut(s) 203
SmoI CTYRAG 1 cut(s) 203
Sse9I AATT 2 cut(s) 288, 300
SsiI CCGC 3 cut(s) 31, 80, 324
StyD4I CCNGG 1 cut(s) 268
TaiI ACGT 2 cut(s) 131, 239
TasI AATT 2 cut(s) 288, 300
TfiI GAWTC 1 cut(s) 52
Tru1I TTAA 1 cut(s) 218
Tru9I TTAA 1 cut(s) 218
TseFI GTSAC 1 cut(s) 237
Tsp45I GTSAC 1 cut(s) 237
TspGWI ACGGA 1 cut(s) 107
VpaK11BI GGWCC 2 cut(s) 21, 47
XapI RAATTY 1 cut(s) 288
XceI RCATGY 1 cut(s) 353
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.