pycom11g17340

cysteine synthase

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr11
N/A
Physical Location & Seq
Forward (+)
19507562 .. 19507906
345 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 288 bp
ATGATTCGTTATCAAAAGCTGTCCGGATTCGAACGGCTACAAGAAAAATCGCCAGGTTTGAAGTGGTGTCTTTATGTTTTTAGTACCAAAACCTGTCCCGGTTCGAACCGCCAACAATGGCGCCTGAGAAGCACGGGCGCTATTGTGGCTGTAGTCTCAGTGTCTATGGCGTTGCTCTCTCTTTTTCTCTACAAGTCCAAGCCGTCCTCCAAAAAGACTGAACTATCCCTGCGCTCGAAGGAAAATCACAGAAATGGCCTCGTTGGTGCCATTGGCACACCCCTCTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
Pfam Domains
Protein Families

Protein Analysis

96

Amino Acids

10.66

Weight (kDa)

10.45

Isoelectric Point (pI)

39.75

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 2 cut(s) 120, 266
AccIII TCCGGA 1 cut(s) 23
AciI CCGC 1 cut(s) 109
AcyI GRCGYC 1 cut(s) 121
AfaI GTAC 1 cut(s) 85
AgsI TTSAA 1 cut(s) 61
AjnI CCWGG 1 cut(s) 52
AluBI AGCT 1 cut(s) 19
AluI AGCT 1 cut(s) 19
Alw26I GTCTC 1 cut(s) 160
Aor13HI TCCGGA 1 cut(s) 23
AoxI GGCC 1 cut(s) 256
AspLEI GCGC 3 cut(s) 123, 140, 234
AsuC2I CCSGG 1 cut(s) 99
AsuII TTCGAA 2 cut(s) 30, 104
BanI GGYRCC 2 cut(s) 120, 266
BceAI ACGGC 2 cut(s) 50, 187
BciT130I CCWGG 1 cut(s) 54
BcnI CCSGG 1 cut(s) 99
BcoDI GTCTC 1 cut(s) 160
BfmI CTRYAG 1 cut(s) 150
BfoI RGCGCY 2 cut(s) 124, 141
Bme1390I CCNGG 2 cut(s) 54, 99
BmiI GGNNCC 2 cut(s) 122, 268
BmrFI CCNGG 2 cut(s) 54, 99
Bpu14I TTCGAA 2 cut(s) 30, 104
BpuMI CCSGG 1 cut(s) 99
BsaHI GRCGYC 1 cut(s) 121
BsaWI WCCGGW 1 cut(s) 23
BseAI TCCGGA 1 cut(s) 23
BseBI CCWGG 1 cut(s) 54
BseMII CTCAG 2 cut(s) 116, 171
BshFI GGCC 1 cut(s) 258
BshNI GGYRCC 2 cut(s) 120, 266
BsiSI CCGG 2 cut(s) 24, 99
BslFI GGGAC 1 cut(s) 81
BsmAI GTCTC 1 cut(s) 160
BsmFI GGGAC 1 cut(s) 81
BsnI GGCC 1 cut(s) 258
Bsp119I TTCGAA 2 cut(s) 30, 104
Bsp13I TCCGGA 1 cut(s) 23
BspACI CCGC 1 cut(s) 109
BspANI GGCC 1 cut(s) 258
BspCNI CTCAG 2 cut(s) 117, 170
BspEI TCCGGA 1 cut(s) 23
BspLI GGNNCC 2 cut(s) 122, 268
BspT104I TTCGAA 2 cut(s) 30, 104
BspT107I GGYRCC 2 cut(s) 120, 266
BssNI GRCGYC 1 cut(s) 121
Bst2UI CCWGG 1 cut(s) 54
BstACI GRCGYC 1 cut(s) 121
BstBI TTCGAA 2 cut(s) 30, 104
BstDEI CTNAG 2 cut(s) 125, 157
BstH2I RGCGCY 2 cut(s) 124, 141
BstHHI GCGC 3 cut(s) 123, 140, 234
BstMAI GTCTC 1 cut(s) 160
BstMWI GCNNNNNNNGC 2 cut(s) 129, 146
BstNI CCWGG 1 cut(s) 54
BstSCI CCNGG 2 cut(s) 52, 97
BstSFI CTRYAG 1 cut(s) 150
BsuRI GGCC 1 cut(s) 258
BtsIMutI CAGTG 1 cut(s) 165
CfoI GCGC 3 cut(s) 123, 140, 234
Csp6I GTAC 1 cut(s) 84
CviJI RGCY 5 cut(s) 19, 37, 149, 202, 258
CviKI_1 RGCY 5 cut(s) 19, 37, 149, 202, 258
CviQI GTAC 1 cut(s) 84
DdeI CTNAG 2 cut(s) 125, 157
DinI GGCGCC 1 cut(s) 122
EcoRII CCWGG 1 cut(s) 52
EgeI GGCGCC 1 cut(s) 122
EheI GGCGCC 1 cut(s) 122
FaiI YATR 2 cut(s) 75, 167
FaqI GGGAC 1 cut(s) 81
GlaI GCGC 3 cut(s) 122, 139, 233
HaeII RGCGCY 2 cut(s) 124, 141
HaeIII GGCC 1 cut(s) 258
HapII CCGG 2 cut(s) 24, 99
HhaI GCGC 3 cut(s) 123, 140, 234
Hin1I GRCGYC 1 cut(s) 121
Hin6I GCGC 3 cut(s) 121, 138, 232
HinP1I GCGC 3 cut(s) 121, 138, 232
HinfI GANTC 2 cut(s) 4, 27
HpaII CCGG 2 cut(s) 24, 99
Hpy188I TCNGA 1 cut(s) 287
Hpy188III TCNNGA 1 cut(s) 24
HpyAV CCTTC 1 cut(s) 232
HpyF10VI GCNNNNNNNGC 2 cut(s) 129, 146
HpyF3I CTNAG 2 cut(s) 125, 157
Hsp92I GRCGYC 1 cut(s) 121
HspAI GCGC 3 cut(s) 121, 138, 232
KasI GGCGCC 1 cut(s) 120
Kpn2I TCCGGA 1 cut(s) 23
LpnPI CCDG 7 cut(s) 37, 39, 66, 106, 112, 137, 242
Mly113I GGCGCC 1 cut(s) 121
MnlI CCTC 2 cut(s) 217, 269
MroI TCCGGA 1 cut(s) 23
MslI CAYNNNNRTG 1 cut(s) 252
MspI CCGG 2 cut(s) 24, 99
MspR9I CCNGG 2 cut(s) 54, 99
MvaI CCWGG 1 cut(s) 54
MwoI GCNNNNNNNGC 2 cut(s) 129, 146
NarI GGCGCC 1 cut(s) 121
NciI CCSGG 1 cut(s) 99
NlaIV GGNNCC 2 cut(s) 122, 268
NspV TTCGAA 2 cut(s) 30, 104
PfeI GAWTC 2 cut(s) 4, 27
PluTI GGCGCC 1 cut(s) 124
Psp6I CCWGG 1 cut(s) 52
PspGI CCWGG 1 cut(s) 52
PspN4I GGNNCC 2 cut(s) 122, 268
RsaI GTAC 1 cut(s) 85
RsaNI GTAC 1 cut(s) 84
RseI CAYNNNNRTG 1 cut(s) 252
ScrFI CCNGG 2 cut(s) 54, 99
SetI ASST 3 cut(s) 21, 58, 95
SfcI CTRYAG 1 cut(s) 150
SfoI GGCGCC 1 cut(s) 122
SfuI TTCGAA 2 cut(s) 30, 104
SmiMI CAYNNNNRTG 1 cut(s) 252
SsiI CCGC 1 cut(s) 109
SspDI GGCGCC 1 cut(s) 120
StyD4I CCNGG 2 cut(s) 52, 97
TaqI TCGA 3 cut(s) 30, 104, 236
TfiI GAWTC 2 cut(s) 4, 27
TscAI CASTG 1 cut(s) 165
TspRI CASTG 1 cut(s) 165
XcmI CCANNNNNNNNNTGG 1 cut(s) 60
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.