pycom11g19040

Autophagy-related protein

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr11
N/A
Physical Location & Seq
Reverse (-)
21309747 .. 21312917
3171 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 270 bp
ATGGTCAATGATGGAAACAGGTATCTGGTTCCTGCTGATTTGACGGTTGGGCAGTTTGTTTATGTAGTCCGAAAGAGGATTAAGCTCAGTGCCGAGAAGGCCATATTTATATTTGTGAATAACATTTTGCCACCCACTGCTGCTATGATGTCTGCAATCTACGAGGAAAACAAAGATGAAGATGGTTTCCTCTACATGACCTACAGCAGTGAAAACACATTCGATGGAACTATCCTCAGCAAATCCCAGGCAAGTTATCCCAAGAGCTAG
Functional Annotation

Protein Analysis

90

Amino Acids

10.03

Weight (kDa)

5.24

Isoelectric Point (pI)

49.77

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
ATG8 PF02991 4 - 74 3.4e-33 Autophagy protein Atg8 ubiquitin like
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AjnI CCWGG 1 cut(s) 246
AluBI AGCT 2 cut(s) 85, 267
AluI AGCT 2 cut(s) 85, 267
AoxI GGCC 1 cut(s) 99
ApeKI GCWGC 1 cut(s) 140
BbvCI CCTCAGC 1 cut(s) 236
BbvI GCAGC 1 cut(s) 127
BccI CCATC 3 cut(s) 5, 176, 218
BciT130I CCWGG 1 cut(s) 248
BfaI CTAG 1 cut(s) 268
BfmI CTRYAG 1 cut(s) 202
BglI GCCNNNNNGGC 1 cut(s) 98
BisI GCNGC 1 cut(s) 141
BlsI GCNGC 1 cut(s) 142
Bme1390I CCNGG 1 cut(s) 248
BmiI GGNNCC 1 cut(s) 30
BmrFI CCNGG 1 cut(s) 248
Bpu10I CCTNAGC 1 cut(s) 236
BsaJI CCNNGG 1 cut(s) 246
BseBI CCWGG 1 cut(s) 248
BseDI CCNNGG 1 cut(s) 246
BseMII CTCAG 2 cut(s) 100, 250
BseXI GCAGC 1 cut(s) 127
BshFI GGCC 1 cut(s) 101
BsnI GGCC 1 cut(s) 101
BspANI GGCC 1 cut(s) 101
BspCNI CTCAG 2 cut(s) 99, 249
BspLI GGNNCC 1 cut(s) 30
BssECI CCNNGG 1 cut(s) 246
Bst2UI CCWGG 1 cut(s) 248
Bst4CI ACNGT 1 cut(s) 46
BstDEI CTNAG 2 cut(s) 86, 236
BstMWI GCNNNNNNNGC 1 cut(s) 98
BstNI CCWGG 1 cut(s) 248
BstSCI CCNGG 1 cut(s) 246
BstSFI CTRYAG 1 cut(s) 202
BstV1I GCAGC 1 cut(s) 127
BsuRI GGCC 1 cut(s) 101
BtsI GCAGTG 2 cut(s) 135, 214
BtsIMutI CAGTG 3 cut(s) 94, 135, 214
CviAII CATG 1 cut(s) 196
CviJI RGCY 3 cut(s) 85, 101, 267
CviKI_1 RGCY 3 cut(s) 85, 101, 267
DdeI CTNAG 2 cut(s) 86, 236
EcoRII CCWGG 1 cut(s) 246
FaeI CATG 1 cut(s) 199
FaiI YATR 5 cut(s) 63, 104, 110, 146, 197
FatI CATG 1 cut(s) 195
Fnu4HI GCNGC 1 cut(s) 141
Fsp4HI GCNGC 1 cut(s) 141
FspBI CTAG 1 cut(s) 268
GluI GCNGC 1 cut(s) 141
HaeIII GGCC 1 cut(s) 101
Hin1II CATG 1 cut(s) 199
Hpy188I TCNGA 1 cut(s) 71
HpyAV CCTTC 1 cut(s) 91
HpyCH4III ACNGT 1 cut(s) 46
HpyCH4V TGCA 1 cut(s) 155
HpyF10VI GCNNNNNNNGC 1 cut(s) 98
HpyF3I CTNAG 2 cut(s) 86, 236
Hsp92II CATG 1 cut(s) 199
LpnPI CCDG 5 cut(s) 4, 11, 45, 233, 260
Lsp1109I GCAGC 1 cut(s) 127
MaeI CTAG 1 cut(s) 268
MboII GAAGA 1 cut(s) 191
MnlI CCTC 4 cut(s) 69, 157, 200, 245
MseI TTAA 1 cut(s) 81
MspR9I CCNGG 1 cut(s) 248
MvaI CCWGG 1 cut(s) 248
MwoI GCNNNNNNNGC 1 cut(s) 98
NlaIII CATG 1 cut(s) 199
NlaIV GGNNCC 1 cut(s) 30
NmeAIII GCCGAG 1 cut(s) 118
PkrI GCNGC 1 cut(s) 142
Psp6I CCWGG 1 cut(s) 246
PspGI CCWGG 1 cut(s) 246
PspN4I GGNNCC 1 cut(s) 30
SaqAI TTAA 1 cut(s) 81
SatI GCNGC 1 cut(s) 141
ScrFI CCNGG 1 cut(s) 248
SetI ASST 4 cut(s) 23, 87, 203, 269
SfcI CTRYAG 1 cut(s) 202
SgeI CNNG 9 cut(s) 31, 38, 44, 106, 175, 208, 259, 260, 264
SspMI CTAG 1 cut(s) 268
StyD4I CCNGG 1 cut(s) 246
TaaI ACNGT 1 cut(s) 46
TaqI TCGA 1 cut(s) 222
Tru1I TTAA 1 cut(s) 81
Tru9I TTAA 1 cut(s) 81
TscAI CASTG 3 cut(s) 94, 142, 214
TseI GCWGC 1 cut(s) 140
TspDTI ATGAA 1 cut(s) 192
TspRI CASTG 3 cut(s) 94, 142, 214
XspI CTAG 1 cut(s) 268
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.