pycom11g21160

GDP-L-fucose synthase

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr11
N/A
Physical Location & Seq
Reverse (-)
24287006 .. 24287401
396 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 279 bp
ATGTCAATGAAAAAAACCAGCCCCACGGCCCTCAGGGCCTTACCCCTCCCATCTCATTCCTTCCCCAGAACCCAGAACCACCATCCCACCCTCCTCTCTCTCGCCATGCCTGAACCCAGAACCACCATCCCACCCCTCTCTTTCTCCCTTTCACGCTACAACAGCGACCTTGTCGGCTCCGCCATCGTCAGCAAGCTCCAAACTCTAGGCTTCACGAATCTTATCCTCCGCACGCACTCCGATCTCAACCTCACCCGTCGACGGCATTCACACCAATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
Pfam Domains
Protein Families

Protein Analysis

93

Amino Acids

10.32

Weight (kDa)

11.79

Isoelectric Point (pI)

56.83

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 259
AciI CCGC 2 cut(s) 180, 229
AfiI CCNNNNNNNGG 1 cut(s) 261
AluBI AGCT 1 cut(s) 196
AluI AGCT 1 cut(s) 196
AoxI GGCC 2 cut(s) 27, 36
AspS9I GGNCC 2 cut(s) 28, 36
AsuHPI GGTGA 1 cut(s) 244
AxyI CCTNAGG 1 cut(s) 32
BccI CCATC 4 cut(s) 58, 90, 134, 191
BceAI ACGGC 1 cut(s) 42
BfaI CTAG 1 cut(s) 206
BglI GCCNNNNNGGC 1 cut(s) 35
BmgT120I GGNCC 2 cut(s) 28, 36
BmiI GGNNCC 1 cut(s) 178
BsaJI CCNNGG 1 cut(s) 24
Bsc4I CCNNNNNNNGG 1 cut(s) 261
Bse21I CCTNAGG 1 cut(s) 32
BseDI CCNNGG 1 cut(s) 24
BseGI GGATG 2 cut(s) 82, 126
BseLI CCNNNNNNNGG 1 cut(s) 261
BseMII CTCAG 1 cut(s) 46
BseRI GAGGAG 1 cut(s) 83
BshFI GGCC 2 cut(s) 29, 38
BslI CCNNNNNNNGG 1 cut(s) 261
BsmI GAATGC 1 cut(s) 265
BsnI GGCC 2 cut(s) 29, 38
Bsp143I GATC 1 cut(s) 241
BspACI CCGC 2 cut(s) 180, 229
BspANI GGCC 2 cut(s) 29, 38
BspCNI CTCAG 1 cut(s) 45
BspLI GGNNCC 1 cut(s) 178
BssECI CCNNGG 1 cut(s) 24
BssMI GATC 1 cut(s) 241
BstC8I GCNNGC 2 cut(s) 194, 233
BstDEI CTNAG 1 cut(s) 32
BstDSI CCRYGG 1 cut(s) 24
BstF5I GGATG 2 cut(s) 82, 126
BstKTI GATC 1 cut(s) 244
BstMBI GATC 1 cut(s) 241
BstMWI GCNNNNNNNGC 2 cut(s) 35, 162
Bsu36I CCTNAGG 1 cut(s) 32
BsuRI GGCC 2 cut(s) 29, 38
BtgI CCRYGG 1 cut(s) 24
BtsCI GGATG 2 cut(s) 82, 126
Cac8I GCNNGC 2 cut(s) 194, 233
Cfr13I GGNCC 2 cut(s) 28, 36
CviAII CATG 1 cut(s) 106
CviJI RGCY 6 cut(s) 21, 29, 38, 177, 196, 210
CviKI_1 RGCY 6 cut(s) 21, 29, 38, 177, 196, 210
DdeI CTNAG 1 cut(s) 32
DpnI GATC 1 cut(s) 243
DpnII GATC 1 cut(s) 241
EciI GGCGGA 1 cut(s) 169
Eco81I CCTNAGG 1 cut(s) 32
EcoO109I RGGNCCY 1 cut(s) 36
FaeI CATG 1 cut(s) 109
FaiI YATR 1 cut(s) 107
FatI CATG 1 cut(s) 105
FblI GTMKAC 1 cut(s) 259
FokI GGATG 2 cut(s) 69, 113
FspBI CTAG 1 cut(s) 206
HaeIII GGCC 2 cut(s) 29, 38
Hin1II CATG 1 cut(s) 109
HincII GTYRAC 1 cut(s) 260
HindII GTYRAC 1 cut(s) 260
HinfI GANTC 1 cut(s) 217
HphI GGTGA 1 cut(s) 244
Hpy166II GTNNAC 1 cut(s) 260
Hpy188I TCNGA 1 cut(s) 241
Hpy188III TCNNGA 1 cut(s) 214
Hpy8I GTNNAC 1 cut(s) 260
Hpy99I CGWCG 2 cut(s) 261, 264
HpyAV CCTTC 1 cut(s) 70
HpyF10VI GCNNNNNNNGC 2 cut(s) 35, 162
HpyF3I CTNAG 1 cut(s) 32
Hsp92II CATG 1 cut(s) 109
Kzo9I GATC 1 cut(s) 241
LmnI GCTCC 2 cut(s) 182, 201
LpnPI CCDG 6 cut(s) 19, 31, 79, 86, 123, 130
MaeI CTAG 1 cut(s) 206
MalI GATC 1 cut(s) 243
MboI GATC 1 cut(s) 241
MnlI CCTC 7 cut(s) 41, 56, 101, 104, 146, 236, 260
Mva1269I GAATGC 1 cut(s) 265
MwoI GCNNNNNNNGC 2 cut(s) 35, 162
NdeII GATC 1 cut(s) 241
NlaIII CATG 1 cut(s) 109
NlaIV GGNNCC 1 cut(s) 178
PctI GAATGC 1 cut(s) 265
PfeI GAWTC 1 cut(s) 217
PflFI GACNNNGTC 1 cut(s) 170
PspN4I GGNNCC 1 cut(s) 178
PspPI GGNCC 2 cut(s) 28, 36
PsyI GACNNNGTC 1 cut(s) 170
SalI GTCGAC 1 cut(s) 258
Sau3AI GATC 1 cut(s) 241
Sau96I GGNCC 2 cut(s) 28, 36
SetI ASST 3 cut(s) 171, 198, 252
SfiI GGCCNNNNNGGCC 1 cut(s) 35
SgrDI CGTCGACG 1 cut(s) 258
SsiI CCGC 2 cut(s) 180, 229
SspMI CTAG 1 cut(s) 206
TaqI TCGA 1 cut(s) 259
TfiI GAWTC 1 cut(s) 217
TspDTI ATGAA 1 cut(s) 23
Tth111I GACNNNGTC 1 cut(s) 170
XmiI GTMKAC 1 cut(s) 259
XspI CTAG 1 cut(s) 206
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.