pycom12397g00210

One of the components of the core complex of photosystem II (PSII). It binds chlorophyll and helps catalyze the primary light-induced photochemical processes of PSII. PSII is a light- driven water plastoquinone oxidoreductase, using light energy to abstract electrons from H(2)O, generating O(2) and a proton gradient subsequently used for ATP formation

Basic Information

Type: gene
Biological Identity
pyrus_communis
tig00012397
N/A
Physical Location & Seq
Forward (+)
116953 .. 117409
457 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 222 bp
ATGCGGAGCTCAACATGTCTGGAAGCACAGGAGAACGTTCTTTTGCGGATATTATTACCAGTATTCGATACTGGTGCGATGGTTAGCTGTTCACGGACTAGCTGTACCTACCGTTTCTTTTTTAGGGTCAATATCAGCAATGCAGTTCATCCAACGATAAACCTAATCCGAATCATAGAGCTACGACACAATCAAACCCGAACGAACAAAGTGTTGAATTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
Pfam Domains
Protein Families

Protein Analysis

74

Amino Acids

8.42

Weight (kDa)

10.1

Isoelectric Point (pI)

63.5

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 2 cut(s) 4, 46
AclI AACGTT 1 cut(s) 36
AfaI GTAC 1 cut(s) 106
AflIII ACRYGT 1 cut(s) 14
AgsI TTSAA 1 cut(s) 217
AluBI AGCT 4 cut(s) 9, 87, 102, 181
AluI AGCT 4 cut(s) 9, 87, 102, 181
Alw21I GWGCWC 1 cut(s) 11
BanII GRGCYC 1 cut(s) 11
Bbv12I GWGCWC 1 cut(s) 11
BccI CCATC 1 cut(s) 73
BcgI CGANNNNNNTGC 2 cut(s) 56, 90
BfaI CTAG 1 cut(s) 99
Bse1I ACTGG 2 cut(s) 59, 76
Bse3DI GCAATG 1 cut(s) 145
BseGI GGATG 1 cut(s) 148
BseMI GCAATG 1 cut(s) 145
BseNI ACTGG 2 cut(s) 59, 76
BsiHKAI GWGCWC 1 cut(s) 11
Bsp1286I GDGCHC 1 cut(s) 11
BspACI CCGC 2 cut(s) 4, 46
BsrDI GCAATG 1 cut(s) 145
BsrI ACTGG 2 cut(s) 59, 76
Bst4CI ACNGT 1 cut(s) 113
BstF5I GGATG 1 cut(s) 148
BstNSI RCATGY 1 cut(s) 18
BtgZI GCGATG 1 cut(s) 92
BtsCI GGATG 1 cut(s) 148
Csp6I GTAC 1 cut(s) 105
CviAII CATG 1 cut(s) 15
CviJI RGCY 4 cut(s) 9, 87, 102, 181
CviKI_1 RGCY 4 cut(s) 9, 87, 102, 181
CviQI GTAC 1 cut(s) 105
Ecl136II GAGCTC 1 cut(s) 9
Eco24I GRGCYC 1 cut(s) 11
Eco53kI GAGCTC 1 cut(s) 9
EcoICRI GAGCTC 1 cut(s) 9
EcoT38I GRGCYC 1 cut(s) 11
FaeI CATG 1 cut(s) 18
FaiI YATR 2 cut(s) 16, 176
FatI CATG 1 cut(s) 14
FokI GGATG 1 cut(s) 135
FriOI GRGCYC 1 cut(s) 11
FspBI CTAG 1 cut(s) 99
Hin1II CATG 1 cut(s) 18
HinfI GANTC 1 cut(s) 171
Hpy166II GTNNAC 1 cut(s) 92
Hpy188I TCNGA 1 cut(s) 170
Hpy188III TCNNGA 1 cut(s) 20
Hpy8I GTNNAC 1 cut(s) 92
HpyCH4III ACNGT 1 cut(s) 113
HpyCH4IV ACGT 1 cut(s) 36
HpyCH4V TGCA 1 cut(s) 143
HpySE526I ACGT 1 cut(s) 36
Hsp92II CATG 1 cut(s) 18
LmnI GCTCC 1 cut(s) 6
LpnPI CCDG 4 cut(s) 5, 14, 57, 72
MaeI CTAG 1 cut(s) 99
MaeII ACGT 1 cut(s) 36
MhlI GDGCHC 1 cut(s) 11
MluCI AATT 1 cut(s) 217
MmeI TCCRAC 1 cut(s) 176
NlaIII CATG 1 cut(s) 18
NspI RCATGY 1 cut(s) 18
PciI ACATGT 1 cut(s) 14
PfeI GAWTC 1 cut(s) 171
PscI ACATGT 1 cut(s) 14
Psp124BI GAGCTC 1 cut(s) 11
Psp1406I AACGTT 1 cut(s) 36
RsaI GTAC 1 cut(s) 106
RsaNI GTAC 1 cut(s) 105
SacI GAGCTC 1 cut(s) 11
SduI GDGCHC 1 cut(s) 11
SetI ASST 7 cut(s) 11, 39, 89, 104, 110, 165, 183
SgeI CNNG 8 cut(s) 27, 32, 41, 71, 84, 105, 111, 210
Sse9I AATT 1 cut(s) 217
SsiI CCGC 2 cut(s) 4, 46
SspMI CTAG 1 cut(s) 99
SstI GAGCTC 1 cut(s) 11
TaaI ACNGT 1 cut(s) 113
TaiI ACGT 1 cut(s) 39
TaqI TCGA 1 cut(s) 66
TasI AATT 1 cut(s) 217
TfiI GAWTC 1 cut(s) 171
TspDTI ATGAA 1 cut(s) 137
TspGWI ACGGA 1 cut(s) 109
XceI RCATGY 1 cut(s) 18
XspI CTAG 1 cut(s) 99
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.