pycom12401g00070

cellular component organization

Basic Information

Type: gene
Biological Identity
pyrus_communis
tig00012401
N/A
Physical Location & Seq
Forward (+)
35847 .. 36243
397 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 288 bp
ATGGTAGAGGTCGATCCCCTATCACCTTCGGTGCCTCCTTGTGCAAGGGATTCTTCGTCGGATTCGTTCAAGCCGTTGCGAATAAACAATTGGCAGAACTCCGCAAGTTGTTATAGGAGTAGGGGCTTTCTAGTATGCTTCTCTCCCCCCTATCCTTTAAAGCGAAGTGGAACCTTTGGAACAAGCTTTGGGCCTAATCGGAGGGTAGAAATTTCTCCCGCAACCTCGATCGCATATTGTCTCATGTACTTCCCTTTGCCTTTCTGCTCACGCCTTGCTTGGACTTGA

Protein Analysis

96

Amino Acids

10.63

Weight (kDa)

9.22

Isoelectric Point (pI)

72.69

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 31
AciI CCGC 2 cut(s) 102, 219
AclWI GGATC 1 cut(s) 8
AcsI RAATTY 1 cut(s) 210
AfaI GTAC 1 cut(s) 248
AgsI TTSAA 1 cut(s) 70
AjuI GAANNNNNNNTTGG 2 cut(s) 73, 105
AluBI AGCT 1 cut(s) 186
AluI AGCT 1 cut(s) 186
Alw26I GTCTC 1 cut(s) 245
AlwI GGATC 1 cut(s) 8
AoxI GGCC 1 cut(s) 191
ApoI RAATTY 1 cut(s) 210
AspS9I GGNCC 1 cut(s) 191
AsuHPI GGTGA 1 cut(s) 15
BanI GGYRCC 1 cut(s) 31
BceAI ACGGC 1 cut(s) 58
BcoDI GTCTC 1 cut(s) 245
BfaI CTAG 1 cut(s) 131
BmgT120I GGNCC 1 cut(s) 191
BmiI GGNNCC 2 cut(s) 33, 172
Bsh1285I CGRYCG 1 cut(s) 231
BshFI GGCC 1 cut(s) 193
BshNI GGYRCC 1 cut(s) 31
BsiEI CGRYCG 1 cut(s) 231
BsmAI GTCTC 1 cut(s) 245
BsnI GGCC 1 cut(s) 193
Bsp143I GATC 2 cut(s) 13, 228
BspACI CCGC 2 cut(s) 102, 219
BspANI GGCC 1 cut(s) 193
BspLI GGNNCC 2 cut(s) 33, 172
BspPI GGATC 1 cut(s) 8
BspT107I GGYRCC 1 cut(s) 31
BssMI GATC 2 cut(s) 13, 228
BstKTI GATC 2 cut(s) 16, 231
BstMAI GTCTC 1 cut(s) 245
BstMBI GATC 2 cut(s) 13, 228
BstMCI CGRYCG 1 cut(s) 231
BsuRI GGCC 1 cut(s) 193
Cfr13I GGNCC 1 cut(s) 191
Csp6I GTAC 1 cut(s) 247
CviAII CATG 1 cut(s) 244
CviJI RGCY 4 cut(s) 73, 126, 186, 193
CviKI_1 RGCY 4 cut(s) 73, 126, 186, 193
CviQI GTAC 1 cut(s) 247
DpnI GATC 2 cut(s) 15, 230
DpnII GATC 2 cut(s) 13, 228
DraI TTTAAA 1 cut(s) 159
FaeI CATG 1 cut(s) 247
FaiI YATR 4 cut(s) 114, 136, 235, 245
FalI AAGNNNNNCTT 2 cut(s) 37, 69
FatI CATG 1 cut(s) 243
FauI CCCGC 1 cut(s) 226
FspBI CTAG 1 cut(s) 131
HaeIII GGCC 1 cut(s) 193
Hin1II CATG 1 cut(s) 247
HindIII AAGCTT 1 cut(s) 184
HinfI GANTC 2 cut(s) 50, 62
HphI GGTGA 1 cut(s) 15
Hpy188I TCNGA 2 cut(s) 61, 201
Hpy99I CGWCG 1 cut(s) 61
HpyAV CCTTC 1 cut(s) 36
HpyCH4V TGCA 1 cut(s) 44
Hsp92II CATG 1 cut(s) 247
Kzo9I GATC 2 cut(s) 13, 228
MaeI CTAG 1 cut(s) 131
MalI GATC 2 cut(s) 15, 230
MboI GATC 2 cut(s) 13, 228
MboII GAAGA 1 cut(s) 45
MfeI CAATTG 1 cut(s) 88
MluCI AATT 2 cut(s) 88, 210
MmeI TCCRAC 1 cut(s) 39
MnlI CCTC 3 cut(s) 45, 195, 235
MseI TTAA 1 cut(s) 158
MunI CAATTG 1 cut(s) 88
NdeII GATC 2 cut(s) 13, 228
NlaIII CATG 1 cut(s) 247
NlaIV GGNNCC 2 cut(s) 33, 172
PcsI WCGNNNNNNNCGW 2 cut(s) 62, 71
PfeI GAWTC 2 cut(s) 50, 62
Ple19I CGATCG 1 cut(s) 231
PspN4I GGNNCC 2 cut(s) 33, 172
PspPI GGNCC 1 cut(s) 191
PvuI CGATCG 1 cut(s) 231
RsaI GTAC 1 cut(s) 248
RsaNI GTAC 1 cut(s) 247
SaqAI TTAA 1 cut(s) 158
Sau3AI GATC 2 cut(s) 13, 228
Sau96I GGNCC 1 cut(s) 191
SetI ASST 5 cut(s) 12, 28, 176, 188, 227
Sse9I AATT 2 cut(s) 88, 210
SsiI CCGC 2 cut(s) 102, 219
SspMI CTAG 1 cut(s) 131
TaqI TCGA 2 cut(s) 12, 227
TasI AATT 2 cut(s) 88, 210
TatI WGTACW 1 cut(s) 246
TfiI GAWTC 2 cut(s) 50, 62
Tru1I TTAA 1 cut(s) 158
Tru9I TTAA 1 cut(s) 158
XapI RAATTY 1 cut(s) 210
XspI CTAG 1 cut(s) 131
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.