pycom12419g00250

No description available

Basic Information

Type: gene
Biological Identity
pyrus_communis
tig00012419
N/A
Physical Location & Seq
Forward (+)
510232 .. 511313
1082 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 471 bp
ATGTGGCTCGTTAACAAATTGGGTTATCACAGAACAAATGGAATTACACAAAGTCAGGTTGCTAAGGAGCTTGGAATTGAAGGGAGAAACTTTCATTATGTAGTGAAGAACCTTGAATGTCAAGGGTTGATTAGGAAAAAAGAAGCTGGTGATGAAGGGGAGTCAAGAAACATTCCGATTGTGAGTAACAACATGTTATACTTGTATCGACATGGTTTTGGAAATGGAAAAGAAAGTCCTGCAAGTGGAGGTGGTTTATCTGGAAAATGTGTTAAAGAGGATGTGCTTGATGAAGACCAGCAAATGAAGTTTAGAAAAAGAAACAAGTGTGAAATGATCGATCAGCTTGTAGAACTTCCAATTGAGCAACAAATTTACGATTTGGTACATGCCACAAGAACAGAGGACTTGACTAGGAATGAGGTGTGTGCATTATACTTTTTTAGAAAAAGGTGTGGCAGTAAGTCTTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

157

Amino Acids

17.86

Weight (kDa)

8.57

Isoelectric Point (pI)

49.07

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
B-block_TFIIIC PF04182 6 - 70 4.6e-11 B-block binding subunit of TFIIIC
DUF7646 PF24657 108 - 144 3.2e-11 Domain of unknown function (DUF7646)
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 372
AfaI GTAC 1 cut(s) 387
AfiI CCNNNNNNNGG 1 cut(s) 245
AflIII ACRYGT 1 cut(s) 192
AgsI TTSAA 2 cut(s) 80, 116
AluBI AGCT 3 cut(s) 70, 146, 346
AluI AGCT 3 cut(s) 70, 146, 346
ApoI RAATTY 1 cut(s) 372
AsuHPI GGTGA 1 cut(s) 161
BbsI GAAGAC 1 cut(s) 300
BfaI CTAG 1 cut(s) 414
BpiI GAAGAC 1 cut(s) 300
Bpu10I CCTNAGC 1 cut(s) 63
Bsa29I ATCGAT 1 cut(s) 339
Bsc4I CCNNNNNNNGG 1 cut(s) 245
BseCI ATCGAT 1 cut(s) 339
BseGI GGATG 1 cut(s) 286
BseLI CCNNNNNNNGG 1 cut(s) 245
BshVI ATCGAT 1 cut(s) 339
BslI CCNNNNNNNGG 1 cut(s) 245
Bsp143I GATC 2 cut(s) 336, 340
BspDI ATCGAT 1 cut(s) 339
BssMI GATC 2 cut(s) 336, 340
BstDEI CTNAG 1 cut(s) 63
BstF5I GGATG 1 cut(s) 286
BstKTI GATC 2 cut(s) 339, 343
BstMBI GATC 2 cut(s) 336, 340
BstNSI RCATGY 2 cut(s) 196, 392
BstV2I GAAGAC 1 cut(s) 300
Bsu15I ATCGAT 1 cut(s) 339
BsuTUI ATCGAT 1 cut(s) 339
BtsCI GGATG 1 cut(s) 286
ClaI ATCGAT 1 cut(s) 339
Csp6I GTAC 1 cut(s) 386
CviAII CATG 3 cut(s) 193, 212, 389
CviJI RGCY 4 cut(s) 7, 70, 146, 346
CviKI_1 RGCY 4 cut(s) 7, 70, 146, 346
CviQI GTAC 1 cut(s) 386
DdeI CTNAG 1 cut(s) 63
DpnI GATC 2 cut(s) 338, 342
DpnII GATC 2 cut(s) 336, 340
FaeI CATG 3 cut(s) 196, 215, 392
FaiI YATR 6 cut(s) 99, 194, 199, 213, 390, 436
FatI CATG 3 cut(s) 192, 211, 388
FokI GGATG 1 cut(s) 293
FspBI CTAG 1 cut(s) 414
Hin1II CATG 3 cut(s) 196, 215, 392
HincII GTYRAC 1 cut(s) 13
HindII GTYRAC 1 cut(s) 13
HinfI GANTC 1 cut(s) 161
HpaI GTTAAC 1 cut(s) 13
HphI GGTGA 1 cut(s) 161
Hpy166II GTNNAC 1 cut(s) 13
Hpy188I TCNGA 1 cut(s) 177
Hpy188III TCNNGA 2 cut(s) 165, 261
Hpy8I GTNNAC 1 cut(s) 13
HpyAV CCTTC 2 cut(s) 74, 149
HpyCH4V TGCA 2 cut(s) 242, 431
HpyF3I CTNAG 1 cut(s) 63
Hsp92II CATG 3 cut(s) 196, 215, 392
KspAI GTTAAC 1 cut(s) 13
Kzo9I GATC 2 cut(s) 336, 340
LmnI GCTCC 1 cut(s) 67
LpnPI CCDG 5 cut(s) 41, 132, 246, 252, 311
MaeI CTAG 1 cut(s) 414
MaeIII GTNAC 1 cut(s) 185
MalI GATC 2 cut(s) 338, 342
MboI GATC 2 cut(s) 336, 340
MboII GAAGA 2 cut(s) 118, 305
MfeI CAATTG 1 cut(s) 360
MluCI AATT 5 cut(s) 17, 42, 75, 360, 372
MlyI GAGTC 1 cut(s) 170
MnlI CCTC 4 cut(s) 242, 271, 397, 415
MseI TTAA 3 cut(s) 12, 273, 469
MunI CAATTG 1 cut(s) 360
NdeII GATC 2 cut(s) 336, 340
NlaIII CATG 3 cut(s) 196, 215, 392
NspI RCATGY 2 cut(s) 196, 392
PciI ACATGT 1 cut(s) 192
PleI GAGTC 1 cut(s) 169
PpsI GAGTC 1 cut(s) 169
PscI ACATGT 1 cut(s) 192
RsaI GTAC 1 cut(s) 387
RsaNI GTAC 1 cut(s) 386
SaqAI TTAA 3 cut(s) 12, 273, 469
Sau3AI GATC 2 cut(s) 336, 340
SchI GAGTC 1 cut(s) 170
SetI ASST 8 cut(s) 60, 72, 114, 148, 253, 348, 426, 455
Sse9I AATT 5 cut(s) 17, 42, 75, 360, 372
SspMI CTAG 1 cut(s) 414
TaqI TCGA 2 cut(s) 208, 339
TasI AATT 5 cut(s) 17, 42, 75, 360, 372
Tru1I TTAA 3 cut(s) 12, 273, 469
Tru9I TTAA 3 cut(s) 12, 273, 469
TspDTI ATGAA 4 cut(s) 83, 168, 306, 320
XapI RAATTY 1 cut(s) 372
XceI RCATGY 2 cut(s) 196, 392
XspI CTAG 1 cut(s) 414
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.