pycom12424g00160

GDSL esterase lipase At5g55050-like

Basic Information

Type: gene
Biological Identity
pyrus_communis
tig00012424
N/A
Physical Location & Seq
Forward (+)
76866 .. 77429
564 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 417 bp
ATGCAAGAAAACAAGCTAACTAAGTCGCATAAATATGCTCTTATCATTTACCAACCCTGGAAAAGGAATTGGTGGAACATATGGCTTGGGAGGAATGAAAGGCTCTTCATCTTCATAAAGTTTAGGAACCTCATGAAAATATGCACAACAAGCTTCCTTTGGTTGTTCGTCATTCTCTTCTTGATCATCACCACCGAATTGATTGTTCTTGAATCATGCTACTCGTTGATTGTTGAAATTGTAAAGTGCTTTGAACAAGTAGCTTCAAAGTTGCAAATGCTTGATTTCGAGCTTCTATTTTGTTCCAACAGCCATGATCAAAGTTCCTCCAAGCAGGGCTATATGTGTTTGACAATGGTTGCAGTGGCTCTTGGTTGGAGAAACACATGCGGTGTGAATCCTCTCGGACAAATGTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

139

Amino Acids

16.31

Weight (kDa)

8.97

Isoelectric Point (pI)

50.06

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 390
AfiI CCNNNNNNNGG 1 cut(s) 63
AgsI TTSAA 4 cut(s) 212, 236, 254, 267
AjnI CCWGG 1 cut(s) 56
AluBI AGCT 4 cut(s) 16, 153, 263, 292
AluI AGCT 4 cut(s) 16, 153, 263, 292
AsuHPI GGTGA 1 cut(s) 181
BciT130I CCWGG 1 cut(s) 58
BclI TGATCA 2 cut(s) 183, 316
Bme1390I CCNGG 1 cut(s) 58
BmiI GGNNCC 1 cut(s) 128
BmrFI CCNGG 1 cut(s) 58
BsaJI CCNNGG 1 cut(s) 56
Bsc4I CCNNNNNNNGG 1 cut(s) 63
BseBI CCWGG 1 cut(s) 58
BseDI CCNNGG 1 cut(s) 56
BseLI CCNNNNNNNGG 1 cut(s) 63
BslI CCNNNNNNNGG 1 cut(s) 63
Bsp143I GATC 2 cut(s) 183, 316
BspACI CCGC 1 cut(s) 390
BspHI TCATGA 1 cut(s) 132
BspLI GGNNCC 1 cut(s) 128
BspQI GCTCTTC 1 cut(s) 110
BssECI CCNNGG 1 cut(s) 56
BssMI GATC 2 cut(s) 183, 316
Bst2UI CCWGG 1 cut(s) 58
Bst6I CTCTTC 2 cut(s) 110, 182
BstDEI CTNAG 1 cut(s) 21
BstENI CCTNNNNNAGG 1 cut(s) 61
BstKTI GATC 2 cut(s) 186, 319
BstMBI GATC 2 cut(s) 183, 316
BstMWI GCNNNNNNNGC 1 cut(s) 150
BstNI CCWGG 1 cut(s) 58
BstNSI RCATGY 1 cut(s) 390
BstSCI CCNGG 1 cut(s) 56
BtsI GCAGTG 1 cut(s) 369
BtsIMutI CAGTG 1 cut(s) 369
CciI TCATGA 1 cut(s) 132
CviAII CATG 4 cut(s) 133, 216, 314, 387
CviJI RGCY 9 cut(s) 16, 85, 103, 153, 263, 292, 312, 339, 368
CviKI_1 RGCY 9 cut(s) 16, 85, 103, 153, 263, 292, 312, 339, 368
DdeI CTNAG 1 cut(s) 21
DpnI GATC 2 cut(s) 185, 318
DpnII GATC 2 cut(s) 183, 316
Eam1104I CTCTTC 2 cut(s) 110, 182
EarI CTCTTC 2 cut(s) 110, 182
EcoNI CCTNNNNNAGG 1 cut(s) 61
EcoRII CCWGG 1 cut(s) 56
FaeI CATG 4 cut(s) 136, 219, 317, 390
FatI CATG 4 cut(s) 132, 215, 313, 386
FauNDI CATATG 1 cut(s) 80
FbaI TGATCA 2 cut(s) 183, 316
Hin1II CATG 4 cut(s) 136, 219, 317, 390
HindIII AAGCTT 1 cut(s) 151
HinfI GANTC 2 cut(s) 212, 397
HphI GGTGA 1 cut(s) 181
Hpy188I TCNGA 1 cut(s) 407
Hpy188III TCNNGA 3 cut(s) 133, 181, 209
HpyCH4V TGCA 4 cut(s) 4, 144, 274, 362
HpyF10VI GCNNNNNNNGC 1 cut(s) 150
HpyF3I CTNAG 1 cut(s) 21
Hsp92II CATG 4 cut(s) 136, 219, 317, 390
Ksp22I TGATCA 2 cut(s) 183, 316
Kzo9I GATC 2 cut(s) 183, 316
LguI GCTCTTC 1 cut(s) 110
LpnPI CCDG 3 cut(s) 43, 70, 320
MalI GATC 2 cut(s) 185, 318
MboI GATC 2 cut(s) 183, 316
MboII GAAGA 3 cut(s) 97, 103, 169
MluCI AATT 3 cut(s) 67, 197, 237
MmeI TCCRAC 2 cut(s) 330, 356
MnlI CCTC 4 cut(s) 84, 140, 337, 411
MslI CAYNNNNRTG 1 cut(s) 33
MspR9I CCNGG 1 cut(s) 58
MvaI CCWGG 1 cut(s) 58
MwoI GCNNNNNNNGC 1 cut(s) 150
NdeI CATATG 1 cut(s) 80
NdeII GATC 2 cut(s) 183, 316
NlaIII CATG 4 cut(s) 136, 219, 317, 390
NlaIV GGNNCC 1 cut(s) 128
NspI RCATGY 1 cut(s) 390
PagI TCATGA 1 cut(s) 132
PciSI GCTCTTC 1 cut(s) 110
PfeI GAWTC 2 cut(s) 212, 397
Psp6I CCWGG 1 cut(s) 56
PspGI CCWGG 1 cut(s) 56
PspN4I GGNNCC 1 cut(s) 128
RseI CAYNNNNRTG 1 cut(s) 33
SapI GCTCTTC 1 cut(s) 110
Sau3AI GATC 2 cut(s) 183, 316
ScrFI CCNGG 1 cut(s) 58
SetI ASST 5 cut(s) 18, 132, 155, 265, 294
SmiMI CAYNNNNRTG 1 cut(s) 33
Sse9I AATT 3 cut(s) 67, 197, 237
SsiI CCGC 1 cut(s) 390
StyD4I CCNGG 1 cut(s) 56
TaqI TCGA 1 cut(s) 288
TasI AATT 3 cut(s) 67, 197, 237
TfiI GAWTC 2 cut(s) 212, 397
TscAI CASTG 1 cut(s) 369
TspDTI ATGAA 4 cut(s) 97, 103, 111, 149
TspRI CASTG 1 cut(s) 369
XagI CCTNNNNNAGG 1 cut(s) 61
XceI RCATGY 1 cut(s) 390
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.