pycom12g01600

No description available

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr12
N/A
Physical Location & Seq
Reverse (-)
1331184 .. 1331533
350 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 219 bp
ATGCTAGAAGAAGAAGATGATGATGATGATGAATGTGAGGATGACGAGTCAGAAACATCGGATAGCAATATTGTTCATGGATCGATCATTGTCGAGGAACAGAGAGAAGTGGATGATGCTTTTGACAGCAGAGAAGACGTGGAGTCGAACACCATTGACATGATGGTGGAACAAGATTTCCGAAAGGAGCTCGACGGGTGGAAGAAAAGTCAAGATTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

73

Amino Acids

8.42

Weight (kDa)

4.05

Isoelectric Point (pI)

68.02

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 88
AhdI GACNNNNNGTC 1 cut(s) 142
AjiI CACGTC 1 cut(s) 139
AloI GAACNNNNNNTCC 2 cut(s) 162, 194
AluBI AGCT 1 cut(s) 190
AluI AGCT 1 cut(s) 190
Alw21I GWGCWC 1 cut(s) 192
AlwI GGATC 1 cut(s) 88
BanII GRGCYC 1 cut(s) 192
BbsI GAAGAC 1 cut(s) 141
Bbv12I GWGCWC 1 cut(s) 192
BccI CCATC 1 cut(s) 157
BfaI CTAG 1 cut(s) 5
BmeRI GACNNNNNGTC 1 cut(s) 142
BmgBI CACGTC 1 cut(s) 139
BmsI GCATC 1 cut(s) 106
BpiI GAAGAC 1 cut(s) 141
Bsa29I ATCGAT 1 cut(s) 83
BseCI ATCGAT 1 cut(s) 83
BseGI GGATG 2 cut(s) 46, 118
BshVI ATCGAT 1 cut(s) 83
BsiHKAI GWGCWC 1 cut(s) 192
Bsp1286I GDGCHC 1 cut(s) 192
Bsp143I GATC 2 cut(s) 80, 84
BspDI ATCGAT 1 cut(s) 83
BspPI GGATC 1 cut(s) 88
BssMI GATC 2 cut(s) 80, 84
BstF5I GGATG 2 cut(s) 46, 118
BstKTI GATC 2 cut(s) 83, 87
BstMBI GATC 2 cut(s) 80, 84
BstV2I GAAGAC 1 cut(s) 141
Bsu15I ATCGAT 1 cut(s) 83
BsuTUI ATCGAT 1 cut(s) 83
BtrI CACGTC 1 cut(s) 139
BtsCI GGATG 2 cut(s) 46, 118
ClaI ATCGAT 1 cut(s) 83
CviAII CATG 2 cut(s) 77, 160
CviJI RGCY 1 cut(s) 190
CviKI_1 RGCY 1 cut(s) 190
DpnI GATC 2 cut(s) 82, 86
DpnII GATC 2 cut(s) 80, 84
DriI GACNNNNNGTC 1 cut(s) 142
Eam1105I GACNNNNNGTC 1 cut(s) 142
Ecl136II GAGCTC 1 cut(s) 190
Eco24I GRGCYC 1 cut(s) 192
Eco53kI GAGCTC 1 cut(s) 190
EcoICRI GAGCTC 1 cut(s) 190
EcoT38I GRGCYC 1 cut(s) 192
FaeI CATG 2 cut(s) 80, 163
FaiI YATR 2 cut(s) 78, 161
FatI CATG 2 cut(s) 76, 159
FokI GGATG 2 cut(s) 53, 125
FriOI GRGCYC 1 cut(s) 192
FspBI CTAG 1 cut(s) 5
Hin1II CATG 2 cut(s) 80, 163
HinfI GANTC 2 cut(s) 47, 143
Hpy188I TCNGA 3 cut(s) 52, 61, 182
Hpy188III TCNNGA 1 cut(s) 212
Hpy99I CGWCG 1 cut(s) 197
HpyCH4IV ACGT 1 cut(s) 138
HpySE526I ACGT 1 cut(s) 138
Hsp92II CATG 2 cut(s) 80, 163
Kzo9I GATC 2 cut(s) 80, 84
LmnI GCTCC 1 cut(s) 187
LweI GCATC 1 cut(s) 106
MaeI CTAG 1 cut(s) 5
MaeII ACGT 1 cut(s) 138
MalI GATC 2 cut(s) 82, 86
MboI GATC 2 cut(s) 80, 84
MboII GAAGA 5 cut(s) 20, 23, 26, 146, 214
MhlI GDGCHC 1 cut(s) 192
MlyI GAGTC 2 cut(s) 56, 152
MnlI CCTC 2 cut(s) 31, 88
MseI TTAA 1 cut(s) 217
MslI CAYNNNNRTG 2 cut(s) 158, 164
NdeII GATC 2 cut(s) 80, 84
NlaIII CATG 2 cut(s) 80, 163
PleI GAGTC 2 cut(s) 55, 151
PpsI GAGTC 2 cut(s) 55, 151
Psp124BI GAGCTC 1 cut(s) 192
RseI CAYNNNNRTG 2 cut(s) 158, 164
SacI GAGCTC 1 cut(s) 192
SaqAI TTAA 1 cut(s) 217
Sau3AI GATC 2 cut(s) 80, 84
SchI GAGTC 2 cut(s) 56, 152
SduI GDGCHC 1 cut(s) 192
SetI ASST 2 cut(s) 141, 192
SfaNI GCATC 1 cut(s) 106
SgeI CNNG 9 cut(s) 17, 58, 89, 106, 151, 172, 185, 203, 208
SmiMI CAYNNNNRTG 2 cut(s) 158, 164
SspI AATATT 1 cut(s) 70
SspMI CTAG 1 cut(s) 5
SstI GAGCTC 1 cut(s) 192
TaiI ACGT 1 cut(s) 141
TaqI TCGA 4 cut(s) 83, 93, 146, 192
Tru1I TTAA 1 cut(s) 217
Tru9I TTAA 1 cut(s) 217
TspDTI ATGAA 2 cut(s) 45, 65
XcmI CCANNNNNNNNNTGG 1 cut(s) 160
XspI CTAG 1 cut(s) 5
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.