pycom12g03620

Trafficking protein particle complex subunit

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr12
N/A
Physical Location & Seq
Forward (+)
3519642 .. 3523933
4292 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 804 bp
ATGGACCCAAGGATTTTGAAGCATTATTTACTAGTGCATGATAATCAAGATGGACCTTTAGAGAAGGCAACTAAAATTTTAACTGAAATGAGGAGCACTTTTGGCTCTGACTGTCAATTACTATGCATTAATTCTTCTCAAGATGGTGTGGTTGAACATCAAGATTATCCCTGGGTGCTTTATAAATTTGAAGATTTACCTAGTCAACCGCTTCGCTGCTTCCTTAATATTAACGATTTTAATGAGATAAGGGATCTTATGCAAGATTTATCAACTAAACACATTATTCCCTACATGGAGCAAAAAATACGTGCGCTTAATCAGCAGGTTGCTGCAACAAGGAAAGGTTTTAGGAATCAAATAAAAAATCTATGGTGGAGAAAAGGAAAAGATGATGTGGTGGATTCTCCCAGTGGCCCTACGTATACCTTTAACTCCATTGAATCCCAAATTAGAGTTTTGGGTGATTATGCCTTCATGCTACGTGATTATGAACTTGCATTGTCAAATTATCGCCTAATATCCACAGATTACAAGCTTGACAAAGCCTGGAAACGCTATGCTGGCGTACAGGAAATGATGGGGCTTGCATATTTCATGTTAGACCAATCAAGAAAGGATGCAGAGTATTGCATGGAAAACGCATTTACTACCTATTTAAAAGTTGCACCATCTAGCCAGCAAAATGCAACTAGGTGTGGTCTTTGGTGGGTGGAGATGTTGAAGGCAAGATATCAGTATAAAGAGGCTGCAACTGTTTACTTCCGTGTTTGTACTGAGAGGAGCCGCTACATTCCGCTGTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
TRAPPC-Trs85 TRAPPC9-Trs120

Protein Analysis

268

Amino Acids

31.47

Weight (kDa)

8.1

Isoelectric Point (pI)

46.0

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
TRAPPC-Trs85 PF12739 2 - 244 7.8e-58 ER-Golgi trafficking TRAPP I complex 85 kDa subunit
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 183
Acc36I ACCTGC 1 cut(s) 316
AccI GTMKAC 1 cut(s) 425
AciI CCGC 3 cut(s) 209, 787, 797
AclWI GGATC 1 cut(s) 261
AcsI RAATTY 2 cut(s) 75, 185
AfaI GTAC 2 cut(s) 570, 775
AgsI TTSAA 5 cut(s) 19, 155, 191, 443, 724
AhlI ACTAGT 1 cut(s) 31
AjnI CCWGG 2 cut(s) 170, 548
AluBI AGCT 1 cut(s) 538
AluI AGCT 1 cut(s) 538
Alw21I GWGCWC 1 cut(s) 98
AlwI GGATC 1 cut(s) 261
AoxI GGCC 1 cut(s) 415
ApeKI GCWGC 3 cut(s) 216, 332, 749
ApoI RAATTY 2 cut(s) 75, 185
AseI ATTAAT 1 cut(s) 129
AspLEI GCGC 1 cut(s) 316
AspS9I GGNCC 3 cut(s) 4, 53, 416
AsuHPI GGTGA 1 cut(s) 476
AvaII GGWCC 2 cut(s) 4, 53
Bbv12I GWGCWC 1 cut(s) 98
BbvI GCAGC 3 cut(s) 203, 319, 736
BccI CCATC 4 cut(s) 44, 137, 574, 679
BciT130I CCWGG 2 cut(s) 172, 550
BcuI ACTAGT 1 cut(s) 31
BfaI CTAG 4 cut(s) 32, 201, 675, 693
BfuAI ACCTGC 1 cut(s) 316
BisI GCNGC 4 cut(s) 217, 333, 750, 787
BlsI GCNGC 4 cut(s) 218, 334, 751, 788
Bme1390I CCNGG 2 cut(s) 172, 550
Bme18I GGWCC 2 cut(s) 4, 53
BmgT120I GGNCC 3 cut(s) 4, 53, 416
BmiI GGNNCC 2 cut(s) 6, 785
BmrFI CCNGG 2 cut(s) 172, 550
BmrI ACTGGG 1 cut(s) 405
BmsI GCATC 1 cut(s) 610
BmuI ACTGGG 1 cut(s) 405
BpuEI CTTGAG 1 cut(s) 123
BsaAI YACGTR 3 cut(s) 311, 423, 485
BsaJI CCNNGG 3 cut(s) 8, 170, 171
Bse1I ACTGG 1 cut(s) 411
BseBI CCWGG 2 cut(s) 172, 550
BseDI CCNNGG 3 cut(s) 8, 170, 171
BseGI GGATG 1 cut(s) 625
BseMII CTCAG 1 cut(s) 768
BseNI ACTGG 1 cut(s) 411
BseRI GAGGAG 2 cut(s) 106, 796
BseXI GCAGC 3 cut(s) 203, 319, 736
BshFI GGCC 1 cut(s) 417
BsiHKAI GWGCWC 1 cut(s) 98
BsnI GGCC 1 cut(s) 417
Bsp1286I GDGCHC 1 cut(s) 98
Bsp143I GATC 1 cut(s) 253
BspACI CCGC 3 cut(s) 209, 787, 797
BspANI GGCC 1 cut(s) 417
BspCNI CTCAG 1 cut(s) 769
BspLI GGNNCC 2 cut(s) 6, 785
BspMI ACCTGC 1 cut(s) 316
BspPI GGATC 1 cut(s) 261
BsrI ACTGG 1 cut(s) 411
BssECI CCNNGG 3 cut(s) 8, 170, 171
BssMI GATC 1 cut(s) 253
BssNAI GTATAC 1 cut(s) 426
BssT1I CCWWGG 1 cut(s) 8
Bst1107I GTATAC 1 cut(s) 426
Bst2UI CCWGG 2 cut(s) 172, 550
Bst4CI ACNGT 2 cut(s) 113, 757
BstBAI YACGTR 3 cut(s) 311, 423, 485
BstC8I GCNNGC 3 cut(s) 565, 588, 680
BstDEI CTNAG 1 cut(s) 777
BstF5I GGATG 1 cut(s) 625
BstHHI GCGC 1 cut(s) 316
BstKTI GATC 1 cut(s) 256
BstMBI GATC 1 cut(s) 253
BstMWI GCNNNNNNNGC 3 cut(s) 102, 322, 564
BstNI CCWGG 2 cut(s) 172, 550
BstSCI CCNGG 2 cut(s) 170, 548
BstSNI TACGTA 1 cut(s) 423
BstV1I GCAGC 3 cut(s) 203, 319, 736
BstX2I RGATCY 1 cut(s) 253
BstYI RGATCY 1 cut(s) 253
BstZ17I GTATAC 1 cut(s) 426
BsuRI GGCC 1 cut(s) 417
BtsCI GGATG 1 cut(s) 625
BtsIMutI CAGTG 1 cut(s) 418
BveI ACCTGC 1 cut(s) 316
Cac8I GCNNGC 3 cut(s) 565, 588, 680
CfoI GCGC 1 cut(s) 316
Cfr13I GGNCC 3 cut(s) 4, 53, 416
Csp6I GTAC 2 cut(s) 569, 774
CviAII CATG 5 cut(s) 38, 295, 478, 598, 634
CviJI RGCY 8 cut(s) 105, 417, 538, 548, 586, 678, 749, 786
CviKI_1 RGCY 8 cut(s) 105, 417, 538, 548, 586, 678, 749, 786
CviQI GTAC 2 cut(s) 569, 774
DdeI CTNAG 1 cut(s) 777
DpnI GATC 1 cut(s) 255
DpnII GATC 1 cut(s) 253
DraI TTTAAA 1 cut(s) 660
Eco105I TACGTA 1 cut(s) 423
Eco130I CCWWGG 1 cut(s) 8
Eco32I GATATC 1 cut(s) 734
Eco47I GGWCC 2 cut(s) 4, 53
EcoRII CCWGG 2 cut(s) 170, 548
EcoRV GATATC 1 cut(s) 734
EcoT14I CCWWGG 1 cut(s) 8
EcoT22I ATGCAT 1 cut(s) 128
ErhI CCWWGG 1 cut(s) 8
FaeI CATG 5 cut(s) 41, 298, 481, 601, 637
FatI CATG 5 cut(s) 37, 294, 477, 597, 633
FblI GTMKAC 1 cut(s) 425
Fnu4HI GCNGC 4 cut(s) 217, 333, 750, 787
FokI GGATG 1 cut(s) 632
Fsp4HI GCNGC 4 cut(s) 217, 333, 750, 787
FspBI CTAG 4 cut(s) 32, 201, 675, 693
GlaI GCGC 1 cut(s) 315
GluI GCNGC 4 cut(s) 217, 333, 750, 787
HaeIII GGCC 1 cut(s) 417
HhaI GCGC 1 cut(s) 316
Hin1II CATG 5 cut(s) 41, 298, 481, 601, 637
Hin6I GCGC 1 cut(s) 314
HinP1I GCGC 1 cut(s) 314
HincII GTYRAC 1 cut(s) 206
HindII GTYRAC 1 cut(s) 206
HindIII AAGCTT 1 cut(s) 536
HinfI GANTC 3 cut(s) 355, 404, 443
HphI GGTGA 1 cut(s) 476
Hpy166II GTNNAC 3 cut(s) 206, 426, 760
Hpy188I TCNGA 1 cut(s) 109
Hpy188III TCNNGA 4 cut(s) 47, 140, 161, 612
Hpy8I GTNNAC 3 cut(s) 206, 426, 760
HpyAV CCTTC 3 cut(s) 58, 484, 718
HpyCH4III ACNGT 2 cut(s) 113, 757
HpyCH4IV ACGT 3 cut(s) 310, 422, 484
HpyF10VI GCNNNNNNNGC 3 cut(s) 102, 322, 564
HpyF3I CTNAG 1 cut(s) 777
HpySE526I ACGT 3 cut(s) 310, 422, 484
Hsp92II CATG 5 cut(s) 41, 298, 481, 601, 637
HspAI GCGC 1 cut(s) 314
Kzo9I GATC 1 cut(s) 253
LmnI GCTCC 3 cut(s) 93, 298, 783
LpnPI CCDG 9 cut(s) 157, 184, 311, 424, 535, 549, 557, 562, 692
Lsp1109I GCAGC 3 cut(s) 203, 319, 736
LweI GCATC 1 cut(s) 610
MaeI CTAG 4 cut(s) 32, 201, 675, 693
MaeII ACGT 3 cut(s) 310, 422, 484
MalI GATC 1 cut(s) 255
MboI GATC 1 cut(s) 253
MboII GAAGA 2 cut(s) 126, 203
MflI RGATCY 1 cut(s) 253
MhlI GDGCHC 1 cut(s) 98
MluCI AATT 6 cut(s) 75, 116, 130, 185, 450, 508
MnlI CCTC 3 cut(s) 84, 739, 774
Mph1103I ATGCAT 1 cut(s) 128
MseI TTAA 8 cut(s) 80, 129, 225, 231, 240, 318, 432, 659
MspA1I CMGCKG 1 cut(s) 799
MspR9I CCNGG 2 cut(s) 172, 550
MvaI CCWGG 2 cut(s) 172, 550
MwoI GCNNNNNNNGC 3 cut(s) 102, 322, 564
NdeII GATC 1 cut(s) 253
NlaIII CATG 5 cut(s) 41, 298, 481, 601, 637
NlaIV GGNNCC 2 cut(s) 6, 785
NsiI ATGCAT 1 cut(s) 128
PasI CCCWGGG 1 cut(s) 171
PfeI GAWTC 3 cut(s) 355, 404, 443
PkrI GCNGC 4 cut(s) 218, 334, 751, 788
Ppu21I YACGTR 3 cut(s) 311, 423, 485
PshBI ATTAAT 1 cut(s) 129
PsiI TTATAA 1 cut(s) 183
Psp6I CCWGG 2 cut(s) 170, 548
PspGI CCWGG 2 cut(s) 170, 548
PspN4I GGNNCC 2 cut(s) 6, 785
PspPI GGNCC 3 cut(s) 4, 53, 416
PsuI RGATCY 1 cut(s) 253
RsaI GTAC 2 cut(s) 570, 775
RsaNI GTAC 2 cut(s) 569, 774
SaqAI TTAA 8 cut(s) 80, 129, 225, 231, 240, 318, 432, 659
SatI GCNGC 4 cut(s) 217, 333, 750, 787
Sau3AI GATC 1 cut(s) 253
Sau96I GGNCC 3 cut(s) 4, 53, 416
ScrFI CCNGG 2 cut(s) 172, 550
SduI GDGCHC 1 cut(s) 98
SfaNI GCATC 1 cut(s) 610
SinI GGWCC 2 cut(s) 4, 53
SmlI CTYRAG 1 cut(s) 138
SmoI CTYRAG 1 cut(s) 138
SnaBI TACGTA 1 cut(s) 423
SpeI ACTAGT 1 cut(s) 31
Sse9I AATT 6 cut(s) 75, 116, 130, 185, 450, 508
SsiI CCGC 3 cut(s) 209, 787, 797
SspI AATATT 1 cut(s) 229
SspMI CTAG 4 cut(s) 32, 201, 675, 693
StyD4I CCNGG 2 cut(s) 170, 548
StyI CCWWGG 1 cut(s) 8
TaaI ACNGT 2 cut(s) 113, 757
TaiI ACGT 3 cut(s) 313, 425, 487
TasI AATT 6 cut(s) 75, 116, 130, 185, 450, 508
TatI WGTACW 1 cut(s) 773
TauI GCSGC 1 cut(s) 789
TfiI GAWTC 3 cut(s) 355, 404, 443
Tru1I TTAA 8 cut(s) 80, 129, 225, 231, 240, 318, 432, 659
Tru9I TTAA 8 cut(s) 80, 129, 225, 231, 240, 318, 432, 659
TscAI CASTG 1 cut(s) 418
TseI GCWGC 3 cut(s) 216, 332, 749
TspDTI ATGAA 3 cut(s) 466, 507, 586
TspGWI ACGGA 1 cut(s) 755
TspRI CASTG 1 cut(s) 418
VpaK11BI GGWCC 2 cut(s) 4, 53
VspI ATTAAT 1 cut(s) 129
XapI RAATTY 2 cut(s) 75, 185
XmiI GTMKAC 1 cut(s) 425
XspI CTAG 4 cut(s) 32, 201, 675, 693
Zsp2I ATGCAT 1 cut(s) 128
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.