pycom12g12140

Component of the cytosolic iron-sulfur (Fe-S) protein assembly (CIA) machinery. Required for the maturation of extramitochondrial Fe-S proteins. Part of an electron transfer chain functioning in an early step of cytosolic Fe-S biogenesis. Transfers electrons from NADPH to the Fe-S cluster of the anamorsin DRE2 homolog

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr12
N/A
Physical Location & Seq
Reverse (-)
14666973 .. 14667282
310 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 201 bp
ATGGTGGGATTCTTTTGGGAAGCAAAGGGTGGAGGGTTTTATGTTGCCTTCTCAAGAGACGACCGGTCCCATAAGAAGGTCTATGTGCAACATACAATGAAAATTATTGCTAAAGAGAGTGGGCTTCCACAAGAATCAGCAGTGAGATATCCTAAAGATTTACAAGATGCCGGAAAATACCATGTCGAAGCATGGAGCTAG

Protein Analysis

67

Amino Acids

7.58

Weight (kDa)

9.0

Isoelectric Point (pI)

46.88

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfiI CCNNNNNNNGG 1 cut(s) 76
AgeI ACCGGT 1 cut(s) 63
AhdI GACNNNNNGTC 1 cut(s) 64
AluBI AGCT 1 cut(s) 198
AluI AGCT 1 cut(s) 198
Alw26I GTCTC 1 cut(s) 51
AsiGI ACCGGT 1 cut(s) 63
AspS9I GGNCC 1 cut(s) 66
AvaII GGWCC 1 cut(s) 66
BcoDI GTCTC 1 cut(s) 51
BfaI CTAG 1 cut(s) 199
Bme18I GGWCC 1 cut(s) 66
BmeRI GACNNNNNGTC 1 cut(s) 64
BmgT120I GGNCC 1 cut(s) 66
BmiI GGNNCC 1 cut(s) 68
BmsI GCATC 1 cut(s) 157
BpuEI CTTGAG 1 cut(s) 37
BsaWI WCCGGW 1 cut(s) 63
Bsc4I CCNNNNNNNGG 1 cut(s) 76
Bse118I RCCGGY 1 cut(s) 63
BseLI CCNNNNNNNGG 1 cut(s) 76
Bsh1285I CGRYCG 1 cut(s) 64
BshTI ACCGGT 1 cut(s) 63
BsiEI CGRYCG 1 cut(s) 64
BsiSI CCGG 2 cut(s) 64, 171
BslFI GGGAC 1 cut(s) 52
BslI CCNNNNNNNGG 1 cut(s) 76
BsmAI GTCTC 1 cut(s) 51
BsmBI CGTCTC 1 cut(s) 51
BsmFI GGGAC 1 cut(s) 52
BspLI GGNNCC 1 cut(s) 68
BsrFI RCCGGY 1 cut(s) 63
BssAI RCCGGY 1 cut(s) 63
BstMAI GTCTC 1 cut(s) 51
BstMCI CGRYCG 1 cut(s) 64
BtsI GCAGTG 1 cut(s) 147
BtsIMutI CAGTG 1 cut(s) 147
Cfr10I RCCGGY 1 cut(s) 63
Cfr13I GGNCC 1 cut(s) 66
CspAI ACCGGT 1 cut(s) 63
CviAII CATG 2 cut(s) 182, 192
CviJI RGCY 2 cut(s) 124, 198
CviKI_1 RGCY 2 cut(s) 124, 198
DriI GACNNNNNGTC 1 cut(s) 64
Eam1105I GACNNNNNGTC 1 cut(s) 64
Eco32I GATATC 1 cut(s) 149
Eco47I GGWCC 1 cut(s) 66
EcoRV GATATC 1 cut(s) 149
Esp3I CGTCTC 1 cut(s) 51
FaeI CATG 2 cut(s) 185, 195
FaiI YATR 6 cut(s) 42, 72, 84, 93, 183, 193
FaqI GGGAC 1 cut(s) 52
FatI CATG 2 cut(s) 181, 191
FspBI CTAG 1 cut(s) 199
HapII CCGG 2 cut(s) 64, 171
Hin1II CATG 2 cut(s) 185, 195
HinfI GANTC 2 cut(s) 9, 134
HpaII CCGG 2 cut(s) 64, 171
Hpy188III TCNNGA 1 cut(s) 54
HpyAV CCTTC 2 cut(s) 58, 70
HpyCH4V TGCA 1 cut(s) 88
Hsp92II CATG 2 cut(s) 185, 195
LmnI GCTCC 1 cut(s) 195
LpnPI CCDG 2 cut(s) 77, 184
LweI GCATC 1 cut(s) 157
MaeI CTAG 1 cut(s) 199
MluCI AATT 1 cut(s) 102
MnlI CCTC 1 cut(s) 26
MspI CCGG 2 cut(s) 64, 171
NlaIII CATG 2 cut(s) 185, 195
NlaIV GGNNCC 1 cut(s) 68
PfeI GAWTC 2 cut(s) 9, 134
PinAI ACCGGT 1 cut(s) 63
PspN4I GGNNCC 1 cut(s) 68
PspPI GGNCC 1 cut(s) 66
Sau96I GGNCC 1 cut(s) 66
SetI ASST 2 cut(s) 81, 200
SfaNI GCATC 1 cut(s) 157
SgeI CNNG 6 cut(s) 66, 76, 143, 176, 183, 194
SinI GGWCC 1 cut(s) 66
SmlI CTYRAG 1 cut(s) 52
SmoI CTYRAG 1 cut(s) 52
Sse9I AATT 1 cut(s) 102
SspMI CTAG 1 cut(s) 199
TaqI TCGA 1 cut(s) 186
TasI AATT 1 cut(s) 102
TfiI GAWTC 2 cut(s) 9, 134
TscAI CASTG 1 cut(s) 147
TspDTI ATGAA 1 cut(s) 113
TspRI CASTG 1 cut(s) 147
VpaK11BI GGWCC 1 cut(s) 66
XspI CTAG 1 cut(s) 199
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.