pycom12g12300

Mitochondrial protein

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr12
N/A
Physical Location & Seq
Forward (+)
14783900 .. 14784253
354 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 354 bp
ATGTCTTCAACAACTTCTCATACTCCAGATGTCATTCATCACACAACAACATTTTCTAGCACAGAAGCATCTCACACTACATCTCCTACACCAGAAACATCTTATTCAACATCTTTACATCTTCCAGCTCCTGTTAATTCCCATCATATGATTACAAGAGTAAAAGAAGGTATTCATAAACTTAAGGTGTTCACTGCCACCAAACATCACCTTTTTTCTACTGTTGACACTTTACCAAATTACCTACTACTCCCTCAATTTTTCTTTAAGCTTCTAAGCATTCCCACTGGATGGAAGCTATACAATATGAGTTTCAGCCTTGCAGTCCACTGGAACTTGGGAATTAGTTCTTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
Pfam Domains
Protein Families

Protein Analysis

118

Amino Acids

13.1

Weight (kDa)

9.1

Isoelectric Point (pI)

34.45

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 291
AfiI CCNNNNNNNGG 1 cut(s) 291
AflII CTTAAG 1 cut(s) 182
AgsI TTSAA 2 cut(s) 9, 108
AluBI AGCT 3 cut(s) 128, 271, 298
AluI AGCT 3 cut(s) 128, 271, 298
AlwNI CAGNNNCTG 1 cut(s) 131
Asp700I GAANNNNTTC 2 cut(s) 171, 346
AsuHPI GGTGA 1 cut(s) 200
BccI CCATC 2 cut(s) 150, 285
BfaI CTAG 1 cut(s) 57
BfrI CTTAAG 1 cut(s) 182
BmsI GCATC 1 cut(s) 77
BpmI CTGGAG 1 cut(s) 9
BsaXI ACNNNNNCTCC 2 cut(s) 67, 97
Bsc4I CCNNNNNNNGG 1 cut(s) 291
Bse1I ACTGG 2 cut(s) 292, 335
BseGI GGATG 1 cut(s) 296
BseLI CCNNNNNNNGG 1 cut(s) 291
BseNI ACTGG 2 cut(s) 292, 335
BslI CCNNNNNNNGG 1 cut(s) 291
BsmI GAATGC 1 cut(s) 279
BspTI CTTAAG 1 cut(s) 182
BsrI ACTGG 2 cut(s) 292, 335
Bst4CI ACNGT 1 cut(s) 223
BstAFI CTTAAG 1 cut(s) 182
BstDEI CTNAG 1 cut(s) 275
BstF5I GGATG 1 cut(s) 296
BtsCI GGATG 1 cut(s) 296
BtsI GCAGTG 1 cut(s) 192
BtsIMutI CAGTG 3 cut(s) 192, 285, 328
CaiI CAGNNNCTG 1 cut(s) 131
CviJI RGCY 4 cut(s) 128, 271, 298, 318
CviKI_1 RGCY 4 cut(s) 128, 271, 298, 318
DdeI CTNAG 1 cut(s) 275
FaiI YATR 6 cut(s) 21, 147, 149, 177, 301, 308
FauNDI CATATG 1 cut(s) 147
FokI GGATG 1 cut(s) 303
FspBI CTAG 1 cut(s) 57
GsuI CTGGAG 1 cut(s) 9
HincII GTYRAC 1 cut(s) 226
HindII GTYRAC 1 cut(s) 226
HindIII AAGCTT 1 cut(s) 269
HphI GGTGA 1 cut(s) 200
Hpy166II GTNNAC 3 cut(s) 192, 226, 328
Hpy188III TCNNGA 1 cut(s) 26
Hpy8I GTNNAC 3 cut(s) 192, 226, 328
HpyAV CCTTC 1 cut(s) 161
HpyCH4III ACNGT 1 cut(s) 223
HpyCH4V TGCA 1 cut(s) 323
HpyF3I CTNAG 1 cut(s) 275
LmnI GCTCC 1 cut(s) 133
LpnPI CCDG 6 cut(s) 39, 105, 138, 144, 273, 316
LweI GCATC 1 cut(s) 77
MaeI CTAG 1 cut(s) 57
MboII GAAGA 1 cut(s) 113
MluCI AATT 4 cut(s) 136, 238, 257, 342
MnlI CCTC 1 cut(s) 264
MroXI GAANNNNTTC 2 cut(s) 171, 346
MseI TTAA 4 cut(s) 135, 183, 267, 352
MspCI CTTAAG 1 cut(s) 182
Mva1269I GAATGC 1 cut(s) 279
NdeI CATATG 1 cut(s) 147
PctI GAATGC 1 cut(s) 279
PdmI GAANNNNTTC 2 cut(s) 171, 346
PflMI CCANNNNNTGG 1 cut(s) 291
PstNI CAGNNNCTG 1 cut(s) 131
SaqAI TTAA 4 cut(s) 135, 183, 267, 352
SetI ASST 7 cut(s) 130, 172, 189, 213, 246, 273, 300
SfaNI GCATC 1 cut(s) 77
SmlI CTYRAG 1 cut(s) 182
SmoI CTYRAG 1 cut(s) 182
Sse9I AATT 4 cut(s) 136, 238, 257, 342
SspMI CTAG 1 cut(s) 57
TaaI ACNGT 1 cut(s) 223
TasI AATT 4 cut(s) 136, 238, 257, 342
Tru1I TTAA 4 cut(s) 135, 183, 267, 352
Tru9I TTAA 4 cut(s) 135, 183, 267, 352
TscAI CASTG 3 cut(s) 199, 292, 335
TspDTI ATGAA 2 cut(s) 26, 164
TspRI CASTG 3 cut(s) 199, 292, 335
Van91I CCANNNNNTGG 1 cut(s) 291
Vha464I CTTAAG 1 cut(s) 182
XmnI GAANNNNTTC 2 cut(s) 171, 346
XspI CTAG 1 cut(s) 57
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.