pycom13g00120

serine threonine-protein phosphatase

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr13
N/A
Physical Location & Seq
Forward (+)
86389 .. 87609
1221 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 183 bp
ATGTTTCAAGATAAAGGCCTTGTAACTGTCTGGTCTGCACCAAATTACTGTTATCGCTGTGGGAATGTAGCTTCTATCTTGAGTTTTAACGACAATATGGAGAGAGAGGTGAAGTTTTTCACTGAAACAGAGGAGAACAACCAGATGAGAGGACCGAGGACAGGAGTACCTTATTTCTTATGA

Protein Analysis

61

Amino Acids

7.0

Weight (kDa)

5.14

Isoelectric Point (pI)

18.97

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfaI GTAC 1 cut(s) 168
AfiI CCNNNNNNNGG 1 cut(s) 161
AgsI TTSAA 1 cut(s) 8
AluBI AGCT 1 cut(s) 71
AluI AGCT 1 cut(s) 71
AoxI GGCC 1 cut(s) 16
Asp700I GAANNNNTTC 1 cut(s) 116
AspS9I GGNCC 1 cut(s) 152
AsuHPI GGTGA 1 cut(s) 121
AvaII GGWCC 1 cut(s) 152
BaeI ACNNNNGTAYC 2 cut(s) 150, 183
Bme18I GGWCC 1 cut(s) 152
BmgT120I GGNCC 1 cut(s) 152
BpuEI CTTGAG 1 cut(s) 100
BsaJI CCNNGG 1 cut(s) 155
Bsc4I CCNNNNNNNGG 1 cut(s) 161
BseDI CCNNGG 1 cut(s) 155
BseLI CCNNNNNNNGG 1 cut(s) 161
BseRI GAGGAG 1 cut(s) 146
BsgI GTGCAG 1 cut(s) 21
BshFI GGCC 1 cut(s) 18
BslI CCNNNNNNNGG 1 cut(s) 161
BsnI GGCC 1 cut(s) 18
BspANI GGCC 1 cut(s) 18
BssECI CCNNGG 1 cut(s) 155
Bst4CI ACNGT 2 cut(s) 28, 50
BsuRI GGCC 1 cut(s) 18
BtsIMutI CAGTG 1 cut(s) 120
Cfr13I GGNCC 1 cut(s) 152
Csp6I GTAC 1 cut(s) 167
CviJI RGCY 2 cut(s) 18, 71
CviKI_1 RGCY 2 cut(s) 18, 71
CviQI GTAC 1 cut(s) 167
Eco147I AGGCCT 1 cut(s) 18
Eco47I GGWCC 1 cut(s) 152
FaiI YATR 2 cut(s) 98, 181
HaeIII GGCC 1 cut(s) 18
HphI GGTGA 1 cut(s) 121
Hpy188III TCNNGA 2 cut(s) 8, 79
HpyCH4III ACNGT 2 cut(s) 28, 50
HpyCH4V TGCA 1 cut(s) 38
LpnPI CCDG 3 cut(s) 16, 147, 155
MaeIII GTNAC 1 cut(s) 22
MluCI AATT 1 cut(s) 43
MnlI CCTC 4 cut(s) 100, 124, 143, 150
MroXI GAANNNNTTC 1 cut(s) 116
MseI TTAA 1 cut(s) 87
PceI AGGCCT 1 cut(s) 18
PdmI GAANNNNTTC 1 cut(s) 116
PspPI GGNCC 1 cut(s) 152
RsaI GTAC 1 cut(s) 168
RsaNI GTAC 1 cut(s) 167
SaqAI TTAA 1 cut(s) 87
Sau96I GGNCC 1 cut(s) 152
SetI ASST 3 cut(s) 73, 111, 172
SgeI CNNG 7 cut(s) 20, 32, 43, 91, 154, 168, 174
SinI GGWCC 1 cut(s) 152
SmlI CTYRAG 1 cut(s) 79
SmoI CTYRAG 1 cut(s) 79
Sse9I AATT 1 cut(s) 43
SseBI AGGCCT 1 cut(s) 18
StuI AGGCCT 1 cut(s) 18
TaaI ACNGT 2 cut(s) 28, 50
TaqII GACCGA 1 cut(s) 169
TasI AATT 1 cut(s) 43
Tru1I TTAA 1 cut(s) 87
Tru9I TTAA 1 cut(s) 87
TscAI CASTG 1 cut(s) 127
TspRI CASTG 1 cut(s) 127
VpaK11BI GGWCC 1 cut(s) 152
XmnI GAANNNNTTC 1 cut(s) 116
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.