pycom13g02990

amino-acid permease

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr13
N/A
Physical Location & Seq
Reverse (-)
2052463 .. 2052669
207 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 207 bp
ATGTTTGTTTCGATATCTTTGCATTCTCTCGGAAGCCTTGTGGCATTCAATGCCATGGTTTCTATCACAAGCATCGGACTGTACATTGCTTATGCCCTACCCATCTTCTTTAGGGTGACCTTGGCACGCAAATCCCTTGTCCCAGGACCTGTCAACTTGGGACACTACGGGGTACTTTTGTTGGTTGAATTTCAGTTAATTGGGTAG

Protein Analysis

69

Amino Acids

7.34

Weight (kDa)

9.52

Isoelectric Point (pI)

25.8

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 188
AfaI GTAC 2 cut(s) 83, 174
AgsI TTSAA 2 cut(s) 49, 188
AjnI CCWGG 1 cut(s) 142
AlwNI CAGNNNCTG 1 cut(s) 149
ApoI RAATTY 1 cut(s) 188
ArsI GACNNNNNNTTYG 2 cut(s) 123, 155
AspS9I GGNCC 1 cut(s) 146
AsuHPI GGTGA 1 cut(s) 127
AvaII GGWCC 1 cut(s) 146
BaeI ACNNNNGTAYC 2 cut(s) 164, 197
BccI CCATC 1 cut(s) 110
BcgI CGANNNNNNTGC 1 cut(s) 35
BciT130I CCWGG 1 cut(s) 144
Bme1390I CCNGG 1 cut(s) 144
Bme18I GGWCC 1 cut(s) 146
BmgT120I GGNCC 1 cut(s) 146
BmrFI CCNGG 1 cut(s) 144
BmsI GCATC 1 cut(s) 81
BsaJI CCNNGG 3 cut(s) 54, 120, 142
Bse3DI GCAATG 1 cut(s) 84
BseBI CCWGG 1 cut(s) 144
BseDI CCNNGG 3 cut(s) 54, 120, 142
BseMI GCAATG 1 cut(s) 84
BslFI GGGAC 2 cut(s) 125, 174
BsmFI GGGAC 2 cut(s) 125, 174
BsmI GAATGC 2 cut(s) 22, 44
Bsp1407I TGTACA 1 cut(s) 81
Bsp19I CCATGG 1 cut(s) 54
BsrDI GCAATG 1 cut(s) 84
BsrGI TGTACA 1 cut(s) 81
BssECI CCNNGG 3 cut(s) 54, 120, 142
BssT1I CCWWGG 2 cut(s) 54, 120
Bst2UI CCWGG 1 cut(s) 144
Bst4CI ACNGT 1 cut(s) 81
BstAPI GCANNNNNTGC 1 cut(s) 50
BstAUI TGTACA 1 cut(s) 81
BstC8I GCNNGC 1 cut(s) 127
BstDSI CCRYGG 1 cut(s) 54
BstEII GGTNACC 1 cut(s) 115
BstMWI GCNNNNNNNGC 1 cut(s) 50
BstNI CCWGG 1 cut(s) 144
BstPI GGTNACC 1 cut(s) 115
BstSCI CCNGG 1 cut(s) 142
BtgI CCRYGG 1 cut(s) 54
Cac8I GCNNGC 1 cut(s) 127
CaiI CAGNNNCTG 1 cut(s) 149
Cfr13I GGNCC 1 cut(s) 146
Csp6I GTAC 2 cut(s) 82, 173
CviAII CATG 1 cut(s) 55
CviJI RGCY 1 cut(s) 36
CviKI_1 RGCY 1 cut(s) 36
CviQI GTAC 2 cut(s) 82, 173
Eco130I CCWWGG 2 cut(s) 54, 120
Eco32I GATATC 1 cut(s) 15
Eco47I GGWCC 1 cut(s) 146
Eco91I GGTNACC 1 cut(s) 115
EcoO109I RGGNCCY 1 cut(s) 146
EcoO65I GGTNACC 1 cut(s) 115
EcoRII CCWGG 1 cut(s) 142
EcoRV GATATC 1 cut(s) 15
EcoT14I CCWWGG 2 cut(s) 54, 120
ErhI CCWWGG 2 cut(s) 54, 120
FaeI CATG 1 cut(s) 58
FaiI YATR 2 cut(s) 56, 93
FaqI GGGAC 2 cut(s) 125, 174
FatI CATG 1 cut(s) 54
Hin1II CATG 1 cut(s) 58
HincII GTYRAC 1 cut(s) 154
HindII GTYRAC 1 cut(s) 154
HphI GGTGA 1 cut(s) 127
Hpy166II GTNNAC 1 cut(s) 154
Hpy188I TCNGA 2 cut(s) 32, 77
Hpy8I GTNNAC 1 cut(s) 154
HpyCH4III ACNGT 1 cut(s) 81
HpyCH4V TGCA 1 cut(s) 22
HpyF10VI GCNNNNNNNGC 1 cut(s) 50
Hsp92II CATG 1 cut(s) 58
LpnPI CCDG 3 cut(s) 129, 156, 162
LweI GCATC 1 cut(s) 81
MaeIII GTNAC 1 cut(s) 115
MboII GAAGA 1 cut(s) 97
MluCI AATT 2 cut(s) 188, 198
MseI TTAA 1 cut(s) 197
MspR9I CCNGG 1 cut(s) 144
Mva1269I GAATGC 2 cut(s) 22, 44
MvaI CCWGG 1 cut(s) 144
MwoI GCNNNNNNNGC 1 cut(s) 50
NcoI CCATGG 1 cut(s) 54
NlaIII CATG 1 cut(s) 58
NmuCI GTSAC 1 cut(s) 115
PctI GAATGC 2 cut(s) 22, 44
PpuMI RGGWCCY 1 cut(s) 146
Psp5II RGGWCCY 1 cut(s) 146
Psp6I CCWGG 1 cut(s) 142
PspEI GGTNACC 1 cut(s) 115
PspGI CCWGG 1 cut(s) 142
PspPI GGNCC 1 cut(s) 146
PspPPI RGGWCCY 1 cut(s) 146
PstNI CAGNNNCTG 1 cut(s) 149
RsaI GTAC 2 cut(s) 83, 174
RsaNI GTAC 2 cut(s) 82, 173
SaqAI TTAA 1 cut(s) 197
Sau96I GGNCC 1 cut(s) 146
ScrFI CCNGG 1 cut(s) 144
SetI ASST 2 cut(s) 122, 151
SfaNI GCATC 1 cut(s) 81
SinI GGWCC 1 cut(s) 146
Sse9I AATT 2 cut(s) 188, 198
StyD4I CCNGG 1 cut(s) 142
StyI CCWWGG 2 cut(s) 54, 120
TaaI ACNGT 1 cut(s) 81
TaqI TCGA 1 cut(s) 11
TasI AATT 2 cut(s) 188, 198
TatI WGTACW 1 cut(s) 81
Tru1I TTAA 1 cut(s) 197
Tru9I TTAA 1 cut(s) 197
TseFI GTSAC 1 cut(s) 115
Tsp45I GTSAC 1 cut(s) 115
VpaK11BI GGWCC 1 cut(s) 146
XapI RAATTY 1 cut(s) 188
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.