pycom13g15840

ubiquitin-protein transferase activity

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr13
N/A
Physical Location & Seq
Forward (+)
11587729 .. 11588836
1108 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 360 bp
ATGAAAGAAGTCCCAACTGCTTGTGGTCCAAATTACCAGGTAAAGGTAGCAAATCAATCCATTAAGTTGTTAATGGCATTATCATCGCTACGAATCTCACCTCTCTATTATGTTGCGACCTCTACATTCAAGAATGAGAAATTATATCATGAATTCACTTTATGGGGGTGGTGTGAATCTTCTGCAACACGAGAAACCAAAAAGATGCACGTTGTCTTTAAGTCCAAGGTGACCAAAGTCACCAAACATTTCAAGTCTCTGAAATCAAAGATGCCCAGATTTGGTATCTTCCCAACTGGAGGGTGCTTTGATGGATGCAGGGATCATTCGTACACAGCAATCCTCAGGATTTGGAACTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

120

Amino Acids

13.67

Weight (kDa)

9.81

Isoelectric Point (pI)

41.98

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 330
AcsI RAATTY 1 cut(s) 152
AfaI GTAC 1 cut(s) 332
AfiI CCNNNNNNNGG 3 cut(s) 43, 281, 299
AgsI TTSAA 2 cut(s) 130, 253
AjnI CCWGG 1 cut(s) 36
Alw26I GTCTC 1 cut(s) 261
AlwI GGATC 1 cut(s) 330
ApoI RAATTY 1 cut(s) 152
AspS9I GGNCC 1 cut(s) 26
AsuHPI GGTGA 3 cut(s) 90, 232, 241
AvaII GGWCC 1 cut(s) 26
AxyI CCTNAGG 1 cut(s) 344
BauI CACGAG 1 cut(s) 189
BccI CCATC 1 cut(s) 305
BcgI CGANNNNNNTGC 2 cut(s) 66, 100
BciT130I CCWGG 1 cut(s) 38
BcoDI GTCTC 1 cut(s) 261
BfaI CTAG 1 cut(s) 358
Bme1390I CCNGG 1 cut(s) 38
Bme18I GGWCC 1 cut(s) 26
BmgT120I GGNCC 1 cut(s) 26
BmrFI CCNGG 1 cut(s) 38
BmsI GCATC 3 cut(s) 195, 261, 305
BoxI GACNNNNGTC 1 cut(s) 236
BpmI CTGGAG 1 cut(s) 318
BsaJI CCNNGG 1 cut(s) 225
Bsc4I CCNNNNNNNGG 3 cut(s) 43, 281, 299
Bse1I ACTGG 1 cut(s) 301
Bse21I CCTNAGG 1 cut(s) 344
BseBI CCWGG 1 cut(s) 38
BseDI CCNNGG 1 cut(s) 225
BseGI GGATG 1 cut(s) 320
BseLI CCNNNNNNNGG 3 cut(s) 43, 281, 299
BseMII CTCAG 1 cut(s) 358
BseNI ACTGG 1 cut(s) 301
BslI CCNNNNNNNGG 3 cut(s) 43, 281, 299
BsmAI GTCTC 1 cut(s) 261
Bsp143I GATC 1 cut(s) 322
BspCNI CTCAG 1 cut(s) 357
BspHI TCATGA 1 cut(s) 148
BspPI GGATC 1 cut(s) 330
BsrI ACTGG 1 cut(s) 301
BssECI CCNNGG 1 cut(s) 225
BssMI GATC 1 cut(s) 322
BssSI CACGAG 1 cut(s) 189
BssT1I CCWWGG 1 cut(s) 225
Bst2BI CACGAG 1 cut(s) 189
Bst2UI CCWGG 1 cut(s) 38
BstDEI CTNAG 1 cut(s) 344
BstEII GGTNACC 1 cut(s) 229
BstF5I GGATG 1 cut(s) 320
BstKTI GATC 1 cut(s) 325
BstMAI GTCTC 1 cut(s) 261
BstMBI GATC 1 cut(s) 322
BstNI CCWGG 1 cut(s) 38
BstPAI GACNNNNGTC 1 cut(s) 236
BstPI GGTNACC 1 cut(s) 229
BstSCI CCNGG 1 cut(s) 36
Bsu36I CCTNAGG 1 cut(s) 344
BtgZI GCGATG 1 cut(s) 69
BtsCI GGATG 1 cut(s) 320
CciI TCATGA 1 cut(s) 148
Cfr13I GGNCC 1 cut(s) 26
CsiI ACCWGGT 1 cut(s) 36
Csp6I GTAC 1 cut(s) 331
CviAII CATG 1 cut(s) 149
CviQI GTAC 1 cut(s) 331
DdeI CTNAG 1 cut(s) 344
DpnI GATC 1 cut(s) 324
DpnII GATC 1 cut(s) 322
Eco130I CCWWGG 1 cut(s) 225
Eco47I GGWCC 1 cut(s) 26
Eco81I CCTNAGG 1 cut(s) 344
Eco91I GGTNACC 1 cut(s) 229
EcoO65I GGTNACC 1 cut(s) 229
EcoRI GAATTC 1 cut(s) 152
EcoRII CCWGG 1 cut(s) 36
EcoT14I CCWWGG 1 cut(s) 225
ErhI CCWWGG 1 cut(s) 225
FaeI CATG 1 cut(s) 152
FaiI YATR 4 cut(s) 111, 145, 150, 163
FatI CATG 1 cut(s) 148
FokI GGATG 1 cut(s) 327
FspBI CTAG 1 cut(s) 358
GsuI CTGGAG 1 cut(s) 318
Hin1II CATG 1 cut(s) 152
HinfI GANTC 2 cut(s) 93, 176
HphI GGTGA 3 cut(s) 90, 232, 241
Hpy166II GTNNAC 1 cut(s) 333
Hpy188I TCNGA 1 cut(s) 261
Hpy188III TCNNGA 3 cut(s) 130, 149, 346
Hpy8I GTNNAC 1 cut(s) 333
HpyCH4IV ACGT 1 cut(s) 210
HpyCH4V TGCA 3 cut(s) 185, 208, 318
HpyF3I CTNAG 1 cut(s) 344
HpySE526I ACGT 1 cut(s) 210
Hsp92II CATG 1 cut(s) 152
Kzo9I GATC 1 cut(s) 322
LpnPI CCDG 6 cut(s) 23, 50, 282, 289, 304, 331
LweI GCATC 3 cut(s) 195, 261, 305
MabI ACCWGGT 1 cut(s) 36
MaeI CTAG 1 cut(s) 358
MaeII ACGT 1 cut(s) 210
MaeIII GTNAC 2 cut(s) 229, 238
MalI GATC 1 cut(s) 324
MboI GATC 1 cut(s) 322
MboII GAAGA 2 cut(s) 171, 280
MluCI AATT 3 cut(s) 31, 140, 152
MnlI CCTC 4 cut(s) 111, 130, 293, 353
MseI TTAA 3 cut(s) 63, 71, 219
MspR9I CCNGG 1 cut(s) 38
MvaI CCWGG 1 cut(s) 38
NdeII GATC 1 cut(s) 322
NlaIII CATG 1 cut(s) 152
NmuCI GTSAC 2 cut(s) 229, 238
PagI TCATGA 1 cut(s) 148
PfeI GAWTC 2 cut(s) 93, 176
PshAI GACNNNNGTC 1 cut(s) 236
Psp6I CCWGG 1 cut(s) 36
PspEI GGTNACC 1 cut(s) 229
PspGI CCWGG 1 cut(s) 36
PspPI GGNCC 1 cut(s) 26
RsaI GTAC 1 cut(s) 332
RsaNI GTAC 1 cut(s) 331
SaqAI TTAA 3 cut(s) 63, 71, 219
Sau3AI GATC 1 cut(s) 322
Sau96I GGNCC 1 cut(s) 26
ScrFI CCNGG 1 cut(s) 38
SetI ASST 6 cut(s) 42, 48, 103, 122, 213, 231
SexAI ACCWGGT 1 cut(s) 36
SfaNI GCATC 3 cut(s) 195, 261, 305
SinI GGWCC 1 cut(s) 26
Sse9I AATT 3 cut(s) 31, 140, 152
SspMI CTAG 1 cut(s) 358
StyD4I CCNGG 1 cut(s) 36
StyI CCWWGG 1 cut(s) 225
TaiI ACGT 1 cut(s) 213
TasI AATT 3 cut(s) 31, 140, 152
TfiI GAWTC 2 cut(s) 93, 176
Tru1I TTAA 3 cut(s) 63, 71, 219
Tru9I TTAA 3 cut(s) 63, 71, 219
TseFI GTSAC 2 cut(s) 229, 238
Tsp45I GTSAC 2 cut(s) 229, 238
TspDTI ATGAA 2 cut(s) 17, 165
VpaK11BI GGWCC 1 cut(s) 26
XapI RAATTY 1 cut(s) 152
XspI CTAG 1 cut(s) 358
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.