pycom13g18310

function. Its presence in a non-photosynthetic plant (Epifagus virginiana) and experiments in tobacco indicate that it has an essential function which is probably not related to photosynthesis

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr13
N/A
Physical Location & Seq
Forward (+)
14391207 .. 14391541
335 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 288 bp
ATGGAGAGATACTATTTAATTTTTTATGGAGAGAAATATTATTTAAGCATCGAGTTACAGTTGCTTAACATATTAATACCTAATGGTTTTCTACAAAAAGATAACGAAAGACATAACCTTTTCAATTCTTTATATTTTCCAATTCGATCTGATCCATTTATTCGGAAAGCTATTTACTCGATCGTAGACATTTCTAGAACACTTTTAACAGAGGGAACGACACCAACCCCCATCAACTTGGATCATTATGGACCATTACCAAATAACTCCCCCAACCACAGTCCATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

96

Amino Acids

11.15

Weight (kDa)

6.25

Isoelectric Point (pI)

58.59

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Ycf2 PF05695 16 - 73 6.9e-17 Ycf2 family
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 186
AclWI GGATC 2 cut(s) 146, 249
AgsI TTSAA 1 cut(s) 124
AluBI AGCT 1 cut(s) 170
AluI AGCT 1 cut(s) 170
AlwI GGATC 2 cut(s) 146, 249
AseI ATTAAT 1 cut(s) 74
AspS9I GGNCC 1 cut(s) 251
AvaII GGWCC 1 cut(s) 251
BccI CCATC 1 cut(s) 239
BfaI CTAG 1 cut(s) 195
Bme18I GGWCC 1 cut(s) 251
BmgT120I GGNCC 1 cut(s) 251
BmsI GCATC 1 cut(s) 57
Bsh1285I CGRYCG 1 cut(s) 183
BsiEI CGRYCG 1 cut(s) 183
Bsp143I GATC 4 cut(s) 146, 151, 180, 241
BspPI GGATC 2 cut(s) 146, 249
BssMI GATC 4 cut(s) 146, 151, 180, 241
Bst4CI ACNGT 2 cut(s) 60, 281
BstKTI GATC 4 cut(s) 149, 154, 183, 244
BstMBI GATC 4 cut(s) 146, 151, 180, 241
BstMCI CGRYCG 1 cut(s) 183
BstXI CCANNNNNNTGG 1 cut(s) 238
Cfr13I GGNCC 1 cut(s) 251
CviJI RGCY 1 cut(s) 170
CviKI_1 RGCY 1 cut(s) 170
DpnI GATC 4 cut(s) 148, 153, 182, 243
DpnII GATC 4 cut(s) 146, 151, 180, 241
Eco47I GGWCC 1 cut(s) 251
FaiI YATR 6 cut(s) 27, 71, 114, 133, 249, 286
FblI GTMKAC 1 cut(s) 186
FspBI CTAG 1 cut(s) 195
Hpy166II GTNNAC 1 cut(s) 187
Hpy188I TCNGA 2 cut(s) 151, 165
Hpy188III TCNNGA 1 cut(s) 195
Hpy8I GTNNAC 1 cut(s) 187
HpyCH4III ACNGT 2 cut(s) 60, 281
Kzo9I GATC 4 cut(s) 146, 151, 180, 241
LweI GCATC 1 cut(s) 57
MaeI CTAG 1 cut(s) 195
MaeIII GTNAC 1 cut(s) 54
MalI GATC 4 cut(s) 148, 153, 182, 243
MboI GATC 4 cut(s) 146, 151, 180, 241
MluCI AATT 3 cut(s) 18, 124, 141
MnlI CCTC 1 cut(s) 205
MseI TTAA 5 cut(s) 17, 44, 66, 74, 206
NdeII GATC 4 cut(s) 146, 151, 180, 241
Ple19I CGATCG 1 cut(s) 183
PshBI ATTAAT 1 cut(s) 74
PspPI GGNCC 1 cut(s) 251
PvuI CGATCG 1 cut(s) 183
SaqAI TTAA 5 cut(s) 17, 44, 66, 74, 206
Sau3AI GATC 4 cut(s) 146, 151, 180, 241
Sau96I GGNCC 1 cut(s) 251
SetI ASST 3 cut(s) 82, 120, 172
SfaNI GCATC 1 cut(s) 57
SgeI CNNG 4 cut(s) 64, 190, 207, 250
SinI GGWCC 1 cut(s) 251
Sse9I AATT 3 cut(s) 18, 124, 141
SspI AATATT 1 cut(s) 38
SspMI CTAG 1 cut(s) 195
TaaI ACNGT 2 cut(s) 60, 281
TaqI TCGA 3 cut(s) 51, 145, 179
TasI AATT 3 cut(s) 18, 124, 141
Tru1I TTAA 5 cut(s) 17, 44, 66, 74, 206
Tru9I TTAA 5 cut(s) 17, 44, 66, 74, 206
VpaK11BI GGWCC 1 cut(s) 251
VspI ATTAAT 1 cut(s) 74
XbaI TCTAGA 1 cut(s) 194
XmiI GTMKAC 1 cut(s) 186
XspI CTAG 1 cut(s) 195
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.