pycom13g19750

transposition

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr13
N/A
Physical Location & Seq
Forward (+)
15696791 .. 15697111
321 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 321 bp
ATGATGCTAACACCAAGATGGAGCCTAGAGCCAATCTGTTTTGGAACTATCTCACCTGAAAGAAGAATGCCTTCACCATTGTTGGTTGATACTCTTTATGAAGTTCCAGGACAAATGCCAAACTTTGGCATAACTCAGGAGAAAGCGCTACCCGAACTAATGTTACCCAAAGAGGCACAGGCCTGGTTAGATGAATTCATCGACCACATTGGAGGCAAGAAGAAGGACTTACTTGAACCTAGCAAATTCCACATAAACATGACATGTTTTATCTGCCATGTTTTGCGCCGAGCTGGATCAACTTGCCATAATGAAGGGTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

107

Amino Acids

12.08

Weight (kDa)

6.05

Isoelectric Point (pI)

72.0

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 125
AclWI GGATC 1 cut(s) 304
AcsI RAATTY 2 cut(s) 194, 245
AfeI AGCGCT 1 cut(s) 147
AfiI CCNNNNNNNGG 1 cut(s) 125
AflIII ACRYGT 1 cut(s) 263
AgsI TTSAA 1 cut(s) 236
AjnI CCWGG 2 cut(s) 106, 182
AluBI AGCT 1 cut(s) 293
AluI AGCT 1 cut(s) 293
AlwI GGATC 1 cut(s) 304
Aor51HI AGCGCT 1 cut(s) 147
AoxI GGCC 1 cut(s) 180
ApoI RAATTY 2 cut(s) 194, 245
Asp700I GAANNNNTTC 1 cut(s) 70
AspLEI GCGC 2 cut(s) 148, 288
AsuHPI GGTGA 2 cut(s) 45, 66
BccI CCATC 1 cut(s) 12
BciT130I CCWGG 2 cut(s) 108, 184
BfaI CTAG 2 cut(s) 26, 240
BfoI RGCGCY 1 cut(s) 149
Bme1390I CCNGG 2 cut(s) 108, 184
BmiI GGNNCC 1 cut(s) 23
BmrFI CCNGG 2 cut(s) 108, 184
Bsc4I CCNNNNNNNGG 1 cut(s) 125
BseBI CCWGG 2 cut(s) 108, 184
BseLI CCNNNNNNNGG 1 cut(s) 125
BseMII CTCAG 1 cut(s) 149
BshFI GGCC 1 cut(s) 182
BslI CCNNNNNNNGG 1 cut(s) 125
BsmI GAATGC 1 cut(s) 72
BsnI GGCC 1 cut(s) 182
Bsp143I GATC 1 cut(s) 296
BspANI GGCC 1 cut(s) 182
BspCNI CTCAG 1 cut(s) 148
BspLI GGNNCC 1 cut(s) 23
BspPI GGATC 1 cut(s) 304
BssMI GATC 1 cut(s) 296
Bst2UI CCWGG 2 cut(s) 108, 184
BstDEI CTNAG 1 cut(s) 135
BstH2I RGCGCY 1 cut(s) 149
BstHHI GCGC 2 cut(s) 148, 288
BstKTI GATC 1 cut(s) 299
BstMBI GATC 1 cut(s) 296
BstNI CCWGG 2 cut(s) 108, 184
BstNSI RCATGY 1 cut(s) 267
BstSCI CCNGG 2 cut(s) 106, 182
BsuRI GGCC 1 cut(s) 182
CfoI GCGC 2 cut(s) 148, 288
CviAII CATG 3 cut(s) 259, 264, 278
CviJI RGCY 4 cut(s) 24, 31, 182, 293
CviKI_1 RGCY 4 cut(s) 24, 31, 182, 293
DdeI CTNAG 1 cut(s) 135
DpnI GATC 1 cut(s) 298
DpnII GATC 1 cut(s) 296
Eco147I AGGCCT 1 cut(s) 182
Eco47III AGCGCT 1 cut(s) 147
EcoRI GAATTC 1 cut(s) 194
EcoRII CCWGG 2 cut(s) 106, 182
FaeI CATG 3 cut(s) 262, 267, 281
FaiI YATR 7 cut(s) 99, 131, 254, 260, 265, 279, 309
FalI AAGNNNNNCTT 4 cut(s) 55, 87, 212, 244
FatI CATG 3 cut(s) 258, 263, 277
FspBI CTAG 2 cut(s) 26, 240
GlaI GCGC 2 cut(s) 147, 287
HaeII RGCGCY 1 cut(s) 149
HaeIII GGCC 1 cut(s) 182
HhaI GCGC 2 cut(s) 148, 288
Hin1II CATG 3 cut(s) 262, 267, 281
Hin6I GCGC 2 cut(s) 146, 286
HinP1I GCGC 2 cut(s) 146, 286
HphI GGTGA 2 cut(s) 45, 66
Hpy188III TCNNGA 1 cut(s) 137
HpyAV CCTTC 3 cut(s) 81, 217, 308
HpyF3I CTNAG 1 cut(s) 135
Hsp92II CATG 3 cut(s) 262, 267, 281
HspAI GCGC 2 cut(s) 146, 286
Kzo9I GATC 1 cut(s) 296
LmnI GCTCC 1 cut(s) 21
LpnPI CCDG 8 cut(s) 69, 93, 120, 122, 164, 169, 196, 279
MaeI CTAG 2 cut(s) 26, 240
MaeIII GTNAC 1 cut(s) 162
MalI GATC 1 cut(s) 298
MboI GATC 1 cut(s) 296
MboII GAAGA 2 cut(s) 75, 232
MluCI AATT 2 cut(s) 194, 245
MnlI CCTC 2 cut(s) 166, 206
MroXI GAANNNNTTC 1 cut(s) 70
MslI CAYNNNNRTG 2 cut(s) 16, 257
MspR9I CCNGG 2 cut(s) 108, 184
Mva1269I GAATGC 1 cut(s) 72
MvaI CCWGG 2 cut(s) 108, 184
NdeII GATC 1 cut(s) 296
NlaIII CATG 3 cut(s) 262, 267, 281
NlaIV GGNNCC 1 cut(s) 23
NmeAIII GCCGAG 1 cut(s) 314
NspI RCATGY 1 cut(s) 267
PceI AGGCCT 1 cut(s) 182
PciI ACATGT 1 cut(s) 263
PctI GAATGC 1 cut(s) 72
PdmI GAANNNNTTC 1 cut(s) 70
PflMI CCANNNNNTGG 1 cut(s) 125
PfoI TCCNGGA 1 cut(s) 106
PscI ACATGT 1 cut(s) 263
Psp6I CCWGG 2 cut(s) 106, 182
PspGI CCWGG 2 cut(s) 106, 182
PspN4I GGNNCC 1 cut(s) 23
PsrI GAACNNNNNNTAC 2 cut(s) 147, 179
RseI CAYNNNNRTG 2 cut(s) 16, 257
Sau3AI GATC 1 cut(s) 296
ScrFI CCNGG 2 cut(s) 108, 184
SetI ASST 3 cut(s) 58, 241, 295
SmiMI CAYNNNNRTG 2 cut(s) 16, 257
Sse9I AATT 2 cut(s) 194, 245
SseBI AGGCCT 1 cut(s) 182
SspMI CTAG 2 cut(s) 26, 240
StuI AGGCCT 1 cut(s) 182
StyD4I CCNGG 2 cut(s) 106, 182
TaqI TCGA 1 cut(s) 201
TasI AATT 2 cut(s) 194, 245
TspDTI ATGAA 3 cut(s) 114, 187, 207
Van91I CCANNNNNTGG 1 cut(s) 125
XapI RAATTY 2 cut(s) 194, 245
XceI RCATGY 1 cut(s) 267
XmnI GAANNNNTTC 1 cut(s) 70
XspI CTAG 2 cut(s) 26, 240
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.