pycom13g21770

Carbon catabolite repressor protein 4 homolog

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr13
N/A
Physical Location & Seq
Reverse (-)
18708059 .. 18708639
581 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 441 bp
ATGAACACAAGAATCCAAAAACCCATACCCATTTCACTAAACATATCAAGATTTATAACCATACCAAAATTTGCAGATCCTGATCTTGCCAATGAAAGTGACCGTCAGCACGCAATTGCATATGTCAATGGAAATAAGATCCCCCAGGAAGATGCCCATAAGGAAAATCTTGATAGAGCACCCAAGATACCATCGCGTCCTCTCTCTTCACATGAAATTTATGAGCTGGGCATTTCATCAAACACCTGGACTGGCTACCAGGATGACAATTCACAACCTGATGTGGCAGTGGAACAAGATGGGAAAACATGGATTGAAATGGGATCTTGGGAATATTATGTACCCACGAAGCATGATATTGGATTTTGTTTGAGACTAAAATTTCAAGTTGTTGATTCTTCAACATGCGTACACAATTGTGCCCAGCAAGAATCAAAGTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
Pfam Domains
Protein Families

Protein Analysis

147

Amino Acids

16.62

Weight (kDa)

5.47

Isoelectric Point (pI)

38.72

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 56
AccII CGCG 1 cut(s) 196
AclWI GGATC 3 cut(s) 71, 133, 331
AcsI RAATTY 3 cut(s) 68, 216, 380
AfaI GTAC 2 cut(s) 342, 411
AgsI TTSAA 3 cut(s) 317, 386, 402
AjnI CCWGG 3 cut(s) 144, 245, 258
AleI CACNNNNGTG 1 cut(s) 417
AluBI AGCT 1 cut(s) 226
AluI AGCT 1 cut(s) 226
Alw21I GWGCWC 1 cut(s) 181
Alw26I GTCTC 1 cut(s) 367
AlwI GGATC 3 cut(s) 71, 133, 331
AlwNI CAGNNNCTG 1 cut(s) 80
ApoI RAATTY 3 cut(s) 68, 216, 380
BaeGI GKGCMC 1 cut(s) 424
Bbv12I GWGCWC 1 cut(s) 181
BccI CCATC 2 cut(s) 199, 293
BciT130I CCWGG 3 cut(s) 146, 247, 260
BcoDI GTCTC 1 cut(s) 367
Bme1390I CCNGG 3 cut(s) 146, 247, 260
BmrFI CCNGG 3 cut(s) 146, 247, 260
BmsI GCATC 1 cut(s) 142
BsaBI GATNNNNATC 1 cut(s) 81
BsaJI CCNNGG 1 cut(s) 144
Bse1I ACTGG 1 cut(s) 256
Bse8I GATNNNNATC 1 cut(s) 81
BseBI CCWGG 3 cut(s) 146, 247, 260
BseDI CCNNGG 1 cut(s) 144
BseGI GGATG 1 cut(s) 268
BseJI GATNNNNATC 1 cut(s) 81
BseNI ACTGG 1 cut(s) 256
BseSI GKGCMC 1 cut(s) 424
BseYI CCCAGC 2 cut(s) 226, 423
Bsh1236I CGCG 1 cut(s) 196
BsiHKAI GWGCWC 1 cut(s) 181
BsmAI GTCTC 1 cut(s) 367
Bsp1286I GDGCHC 2 cut(s) 181, 424
Bsp143I GATC 4 cut(s) 76, 82, 138, 323
BspFNI CGCG 1 cut(s) 196
BspPI GGATC 3 cut(s) 71, 133, 331
BsrI ACTGG 1 cut(s) 256
BssECI CCNNGG 1 cut(s) 144
BssMI GATC 4 cut(s) 76, 82, 138, 323
Bst2UI CCWGG 3 cut(s) 146, 247, 260
Bst4CI ACNGT 1 cut(s) 104
Bst6I CTCTTC 1 cut(s) 211
BstC8I GCNNGC 1 cut(s) 111
BstF5I GGATG 1 cut(s) 268
BstFNI CGCG 1 cut(s) 196
BstKTI GATC 4 cut(s) 79, 85, 141, 326
BstMAI GTCTC 1 cut(s) 367
BstMBI GATC 4 cut(s) 76, 82, 138, 323
BstNI CCWGG 3 cut(s) 146, 247, 260
BstNSI RCATGY 1 cut(s) 408
BstSCI CCNGG 3 cut(s) 144, 245, 258
BstSLI GKGCMC 1 cut(s) 424
BstUI CGCG 1 cut(s) 196
BstX2I RGATCY 3 cut(s) 76, 138, 323
BstYI RGATCY 3 cut(s) 76, 138, 323
BtgZI GCGATG 1 cut(s) 177
BtsCI GGATG 1 cut(s) 268
BtsI GCAGTG 1 cut(s) 294
BtsIMutI CAGTG 1 cut(s) 294
Cac8I GCNNGC 1 cut(s) 111
CaiI CAGNNNCTG 1 cut(s) 80
CseI GACGC 1 cut(s) 185
Csp6I GTAC 2 cut(s) 341, 410
CviAII CATG 4 cut(s) 212, 309, 353, 405
CviJI RGCY 2 cut(s) 226, 255
CviKI_1 RGCY 2 cut(s) 226, 255
CviQI GTAC 2 cut(s) 341, 410
DpnI GATC 4 cut(s) 78, 84, 140, 325
DpnII GATC 4 cut(s) 76, 82, 138, 323
Eam1104I CTCTTC 1 cut(s) 211
EarI CTCTTC 1 cut(s) 211
EcoRII CCWGG 3 cut(s) 144, 245, 258
FaeI CATG 4 cut(s) 215, 312, 356, 408
FatI CATG 4 cut(s) 211, 308, 352, 404
FauNDI CATATG 1 cut(s) 121
FokI GGATG 1 cut(s) 275
GsaI CCCAGC 2 cut(s) 230, 427
HgaI GACGC 1 cut(s) 185
Hin1II CATG 4 cut(s) 215, 312, 356, 408
HinfI GANTC 3 cut(s) 12, 395, 431
Hpy166II GTNNAC 1 cut(s) 412
Hpy188III TCNNGA 3 cut(s) 48, 80, 170
Hpy8I GTNNAC 1 cut(s) 412
HpyCH4III ACNGT 1 cut(s) 104
HpyCH4V TGCA 2 cut(s) 74, 119
Hsp92II CATG 4 cut(s) 215, 312, 356, 408
Kzo9I GATC 4 cut(s) 76, 82, 138, 323
LweI GCATC 1 cut(s) 142
MaeIII GTNAC 1 cut(s) 98
MalI GATC 4 cut(s) 78, 84, 140, 325
MboI GATC 4 cut(s) 76, 82, 138, 323
MboII GAAGA 3 cut(s) 161, 198, 390
MfeI CAATTG 2 cut(s) 114, 415
MflI RGATCY 3 cut(s) 76, 138, 323
MhlI GDGCHC 2 cut(s) 181, 424
MluCI AATT 6 cut(s) 68, 114, 216, 268, 380, 415
MnlI CCTC 1 cut(s) 210
MslI CAYNNNNRTG 1 cut(s) 417
MspR9I CCNGG 3 cut(s) 146, 247, 260
MunI CAATTG 2 cut(s) 114, 415
MvaI CCWGG 3 cut(s) 146, 247, 260
MvnI CGCG 1 cut(s) 196
NdeI CATATG 1 cut(s) 121
NdeII GATC 4 cut(s) 76, 82, 138, 323
NlaIII CATG 4 cut(s) 215, 312, 356, 408
NmuCI GTSAC 1 cut(s) 98
NspI RCATGY 1 cut(s) 408
OliI CACNNNNGTG 1 cut(s) 417
PfeI GAWTC 3 cut(s) 12, 395, 431
PsiI TTATAA 1 cut(s) 56
Psp6I CCWGG 3 cut(s) 144, 245, 258
PspFI CCCAGC 2 cut(s) 226, 423
PspGI CCWGG 3 cut(s) 144, 245, 258
PstNI CAGNNNCTG 1 cut(s) 80
PsuI RGATCY 3 cut(s) 76, 138, 323
RsaI GTAC 2 cut(s) 342, 411
RsaNI GTAC 2 cut(s) 341, 410
RseI CAYNNNNRTG 1 cut(s) 417
Sau3AI GATC 4 cut(s) 76, 82, 138, 323
ScrFI CCNGG 3 cut(s) 146, 247, 260
SduI GDGCHC 2 cut(s) 181, 424
SetI ASST 3 cut(s) 228, 248, 280
SfaNI GCATC 1 cut(s) 142
SmiMI CAYNNNNRTG 1 cut(s) 417
Sse9I AATT 6 cut(s) 68, 114, 216, 268, 380, 415
SspI AATATT 1 cut(s) 335
StyD4I CCNGG 3 cut(s) 144, 245, 258
TaaI ACNGT 1 cut(s) 104
TasI AATT 6 cut(s) 68, 114, 216, 268, 380, 415
TfiI GAWTC 3 cut(s) 12, 395, 431
TscAI CASTG 1 cut(s) 294
TseFI GTSAC 1 cut(s) 98
Tsp45I GTSAC 1 cut(s) 98
TspDTI ATGAA 4 cut(s) 17, 108, 225, 228
TspRI CASTG 1 cut(s) 294
XapI RAATTY 3 cut(s) 68, 216, 380
XceI RCATGY 1 cut(s) 408
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.