pycom14g01670

Elongation factor G C-terminus

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr14
N/A
Physical Location & Seq
Forward (+)
1214983 .. 1215471
489 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 324 bp
ATGATCTCTTTCAGTCCACCCCTCTTTTTTTATGATCATTTCCCACAAATGGTTCGAACAAGAGCAAGCGACTTCAACATTTATAGAGGAACTTGTATATGTATGGCATTTCATGATCACTTCAACAAGCGGAGATCGATCATTTCCCACAATTCGTCGCTCAATCACTTTCAATTGAAGTATTTTGCTTACATGAGGTTAGTGCGTATTGTTCATGAGGTTAATTGGATTGTGAGTGCGTACAAGAGCGAGAAATACTTGTCCGACATGGATGCTACACTTTCTGGGCCGGCGGGGGATGTGGGGGTAGTGATGAAAATCTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
Pfam Domains
Protein Families

Protein Analysis

108

Amino Acids

12.52

Weight (kDa)

9.26

Isoelectric Point (pI)

47.0

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 2 cut(s) 130, 293
AfaI GTAC 1 cut(s) 242
AfiI CCNNNNNNNGG 1 cut(s) 49
AgsI TTSAA 4 cut(s) 76, 124, 173, 178
AoxI GGCC 1 cut(s) 287
AspS9I GGNCC 1 cut(s) 287
AsuII TTCGAA 1 cut(s) 55
BcgI CGANNNNNNTGC 2 cut(s) 254, 288
BclI TGATCA 2 cut(s) 34, 115
BmgT120I GGNCC 1 cut(s) 287
BmsI GCATC 1 cut(s) 262
Bpu14I TTCGAA 1 cut(s) 55
Bsa29I ATCGAT 1 cut(s) 137
BsaBI GATNNNNATC 1 cut(s) 317
Bsc4I CCNNNNNNNGG 1 cut(s) 49
Bse118I RCCGGY 1 cut(s) 289
Bse8I GATNNNNATC 1 cut(s) 317
BseCI ATCGAT 1 cut(s) 137
BseGI GGATG 2 cut(s) 277, 304
BseJI GATNNNNATC 1 cut(s) 317
BseLI CCNNNNNNNGG 1 cut(s) 49
BshFI GGCC 1 cut(s) 289
BshVI ATCGAT 1 cut(s) 137
BsiSI CCGG 1 cut(s) 290
BslI CCNNNNNNNGG 1 cut(s) 49
BsnI GGCC 1 cut(s) 289
Bsp119I TTCGAA 1 cut(s) 55
Bsp143I GATC 5 cut(s) 3, 34, 115, 134, 138
BspACI CCGC 2 cut(s) 130, 293
BspANI GGCC 1 cut(s) 289
BspDI ATCGAT 1 cut(s) 137
BspHI TCATGA 2 cut(s) 112, 214
BspT104I TTCGAA 1 cut(s) 55
BsrFI RCCGGY 1 cut(s) 289
BssAI RCCGGY 1 cut(s) 289
BssMI GATC 5 cut(s) 3, 34, 115, 134, 138
BstBI TTCGAA 1 cut(s) 55
BstC8I GCNNGC 2 cut(s) 67, 291
BstF5I GGATG 2 cut(s) 277, 304
BstKTI GATC 5 cut(s) 6, 37, 118, 137, 141
BstMBI GATC 5 cut(s) 3, 34, 115, 134, 138
Bsu15I ATCGAT 1 cut(s) 137
BsuRI GGCC 1 cut(s) 289
BsuTUI ATCGAT 1 cut(s) 137
BtsCI GGATG 2 cut(s) 277, 304
Cac8I GCNNGC 2 cut(s) 67, 291
CciI TCATGA 2 cut(s) 112, 214
Cfr10I RCCGGY 1 cut(s) 289
Cfr13I GGNCC 1 cut(s) 287
ClaI ATCGAT 1 cut(s) 137
Csp6I GTAC 1 cut(s) 241
CviAII CATG 4 cut(s) 113, 193, 215, 268
CviJI RGCY 1 cut(s) 289
CviKI_1 RGCY 1 cut(s) 289
CviQI GTAC 1 cut(s) 241
DpnI GATC 5 cut(s) 5, 36, 117, 136, 140
DpnII GATC 5 cut(s) 3, 34, 115, 134, 138
FaeI CATG 4 cut(s) 116, 196, 218, 271
FaiI YATR 9 cut(s) 33, 84, 98, 100, 104, 114, 194, 216, 269
FatI CATG 4 cut(s) 112, 192, 214, 267
FauI CCCGC 1 cut(s) 286
FbaI TGATCA 2 cut(s) 34, 115
FokI GGATG 2 cut(s) 284, 311
HaeIII GGCC 1 cut(s) 289
HapII CCGG 1 cut(s) 290
Hin1II CATG 4 cut(s) 116, 196, 218, 271
HpaII CCGG 1 cut(s) 290
Hpy166II GTNNAC 1 cut(s) 17
Hpy188I TCNGA 2 cut(s) 265, 323
Hpy188III TCNNGA 2 cut(s) 113, 215
Hpy8I GTNNAC 1 cut(s) 17
Hpy99I CGWCG 1 cut(s) 160
Hsp92II CATG 4 cut(s) 116, 196, 218, 271
KroI GCCGGC 1 cut(s) 289
KroNI GCCGGC 1 cut(s) 291
Ksp22I TGATCA 2 cut(s) 34, 115
Kzo9I GATC 5 cut(s) 3, 34, 115, 134, 138
LpnPI CCDG 2 cut(s) 270, 303
LweI GCATC 1 cut(s) 262
MalI GATC 5 cut(s) 5, 36, 117, 136, 140
MboI GATC 5 cut(s) 3, 34, 115, 134, 138
MfeI CAATTG 1 cut(s) 173
MluCI AATT 3 cut(s) 151, 173, 223
MmeI TCCRAC 1 cut(s) 288
MnlI CCTC 4 cut(s) 32, 80, 189, 211
MroNI GCCGGC 1 cut(s) 289
MseI TTAA 1 cut(s) 222
MspI CCGG 1 cut(s) 290
MunI CAATTG 1 cut(s) 173
NaeI GCCGGC 1 cut(s) 291
NdeII GATC 5 cut(s) 3, 34, 115, 134, 138
NgoMIV GCCGGC 1 cut(s) 289
NlaIII CATG 4 cut(s) 116, 196, 218, 271
NspV TTCGAA 1 cut(s) 55
PagI TCATGA 2 cut(s) 112, 214
PdiI GCCGGC 1 cut(s) 291
PspPI GGNCC 1 cut(s) 287
RsaI GTAC 1 cut(s) 242
RsaNI GTAC 1 cut(s) 241
SaqAI TTAA 1 cut(s) 222
Sau3AI GATC 5 cut(s) 3, 34, 115, 134, 138
Sau96I GGNCC 1 cut(s) 287
SetI ASST 2 cut(s) 200, 222
SfaNI GCATC 1 cut(s) 262
SfuI TTCGAA 1 cut(s) 55
Sse9I AATT 3 cut(s) 151, 173, 223
SsiI CCGC 2 cut(s) 130, 293
TaqI TCGA 2 cut(s) 55, 137
TasI AATT 3 cut(s) 151, 173, 223
Tru1I TTAA 1 cut(s) 222
Tru9I TTAA 1 cut(s) 222
TspDTI ATGAA 2 cut(s) 101, 203
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.