pycom14g05180

No description available

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr14
N/A
Physical Location & Seq
Forward (+)
4979462 .. 4979808
347 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 252 bp
ATGAACTCACTTTTCATTTTATGCATAGCCTTATGTTCCCCAGGATTTTCACGTCTGCCTAACATGCTGTCAACCTCATCAACAAAAACAACACTAGGGGCAATTTTACTAGCTAAGGAGAACACCACTTTAATGTACTTTTCTCCTTCCCCAAACCACTTTGAAGTAATACTTGACATTGATATGTTAATAAAGTTTGCACCAGCTTCAGTTGCAATAGCCTTTGCAAGCATAGTCCACCAACTCCTGTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

84

Amino Acids

9.0

Weight (kDa)

6.69

Isoelectric Point (pI)

44.16

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcuI CTGAAG 1 cut(s) 192
AfaI GTAC 1 cut(s) 137
AgsI TTSAA 1 cut(s) 164
AjiI CACGTC 1 cut(s) 53
AjnI CCWGG 1 cut(s) 40
AluBI AGCT 2 cut(s) 113, 206
AluI AGCT 2 cut(s) 113, 206
BciT130I CCWGG 1 cut(s) 42
BfaI CTAG 2 cut(s) 95, 110
BfmI CTRYAG 1 cut(s) 248
Bme1390I CCNGG 1 cut(s) 42
BmgBI CACGTC 1 cut(s) 53
BmrFI CCNGG 1 cut(s) 42
Bpu10I CCTNAGC 1 cut(s) 114
BsaJI CCNNGG 1 cut(s) 40
BseBI CCWGG 1 cut(s) 42
BseDI CCNNGG 1 cut(s) 40
BssECI CCNNGG 1 cut(s) 40
Bst2UI CCWGG 1 cut(s) 42
BstC8I GCNNGC 1 cut(s) 229
BstDEI CTNAG 1 cut(s) 114
BstMWI GCNNNNNNNGC 2 cut(s) 64, 212
BstNI CCWGG 1 cut(s) 42
BstNSI RCATGY 1 cut(s) 67
BstSCI CCNGG 1 cut(s) 40
BstSFI CTRYAG 1 cut(s) 248
BtrI CACGTC 1 cut(s) 53
Cac8I GCNNGC 1 cut(s) 229
Csp6I GTAC 1 cut(s) 136
CviAII CATG 1 cut(s) 64
CviJI RGCY 4 cut(s) 29, 113, 206, 221
CviKI_1 RGCY 4 cut(s) 29, 113, 206, 221
CviQI GTAC 1 cut(s) 136
DdeI CTNAG 1 cut(s) 114
Eco57I CTGAAG 1 cut(s) 192
EcoRII CCWGG 1 cut(s) 40
EcoT22I ATGCAT 1 cut(s) 26
FaeI CATG 1 cut(s) 67
FaiI YATR 6 cut(s) 22, 26, 34, 65, 185, 233
FalI AAGNNNNNCTT 2 cut(s) 156, 188
FatI CATG 1 cut(s) 63
FspBI CTAG 2 cut(s) 95, 110
Hin1II CATG 1 cut(s) 67
HincII GTYRAC 1 cut(s) 72
HindII GTYRAC 1 cut(s) 72
Hpy166II GTNNAC 2 cut(s) 72, 238
Hpy8I GTNNAC 2 cut(s) 72, 238
HpyAV CCTTC 1 cut(s) 156
HpyCH4IV ACGT 1 cut(s) 52
HpyCH4V TGCA 4 cut(s) 24, 200, 215, 227
HpyF10VI GCNNNNNNNGC 2 cut(s) 64, 212
HpyF3I CTNAG 1 cut(s) 114
HpySE526I ACGT 1 cut(s) 52
Hsp92II CATG 1 cut(s) 67
LpnPI CCDG 3 cut(s) 27, 54, 216
MaeI CTAG 2 cut(s) 95, 110
MaeII ACGT 1 cut(s) 52
MluCI AATT 1 cut(s) 102
MnlI CCTC 1 cut(s) 85
Mph1103I ATGCAT 1 cut(s) 26
MseI TTAA 2 cut(s) 131, 188
MslI CAYNNNNRTG 2 cut(s) 131, 182
MspR9I CCNGG 1 cut(s) 42
MvaI CCWGG 1 cut(s) 42
MwoI GCNNNNNNNGC 2 cut(s) 64, 212
NlaIII CATG 1 cut(s) 67
NsiI ATGCAT 1 cut(s) 26
NspI RCATGY 1 cut(s) 67
Psp6I CCWGG 1 cut(s) 40
PspGI CCWGG 1 cut(s) 40
RsaI GTAC 1 cut(s) 137
RsaNI GTAC 1 cut(s) 136
RseI CAYNNNNRTG 2 cut(s) 131, 182
SaqAI TTAA 2 cut(s) 131, 188
ScrFI CCNGG 1 cut(s) 42
SetI ASST 4 cut(s) 55, 77, 115, 208
SfcI CTRYAG 1 cut(s) 248
SgeI CNNG 9 cut(s) 53, 54, 63, 76, 107, 122, 185, 215, 240
SmiMI CAYNNNNRTG 2 cut(s) 131, 182
Sse9I AATT 1 cut(s) 102
SspMI CTAG 2 cut(s) 95, 110
StyD4I CCNGG 1 cut(s) 40
TaiI ACGT 1 cut(s) 55
TasI AATT 1 cut(s) 102
TatI WGTACW 1 cut(s) 135
Tru1I TTAA 2 cut(s) 131, 188
Tru9I TTAA 2 cut(s) 131, 188
TspDTI ATGAA 2 cut(s) 4, 17
XceI RCATGY 1 cut(s) 67
XspI CTAG 2 cut(s) 95, 110
Zsp2I ATGCAT 1 cut(s) 26
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.