pycom14g13420

Belongs to the glycosyl hydrolase 1 family

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr14
N/A
Physical Location & Seq
Forward (+)
16373704 .. 16373898
195 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 195 bp
ATGTTACCATATATTTCTGTTCCACAATATTCGGAAAAACCGATGCTGCAACTCCGCGGAAACACGATGGAGGACGCAATTGATGCTGGCAGAGAAAAGGGAGATTCCGATGGAGAAAGGGGTAGTGTGGTTGTAACTGCTGGTGATATTGTTACAGCAAACACCAGAAACAAAGTCGTAATATCTTTTGGGTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
Pfam Domains
Protein Families

Protein Analysis

65

Amino Acids

6.89

Weight (kDa)

4.81

Isoelectric Point (pI)

23.65

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccII CGCG 1 cut(s) 57
AciI CCGC 2 cut(s) 55, 57
ApeKI GCWGC 1 cut(s) 46
AsuHPI GGTGA 1 cut(s) 155
BbvI GCAGC 1 cut(s) 33
BccI CCATC 2 cut(s) 61, 104
BisI GCNGC 1 cut(s) 47
BlsI GCNGC 1 cut(s) 48
BmsI GCATC 2 cut(s) 33, 73
BsaJI CCNNGG 1 cut(s) 55
BseDI CCNNGG 1 cut(s) 55
BseXI GCAGC 1 cut(s) 33
Bsh1236I CGCG 1 cut(s) 57
BspACI CCGC 2 cut(s) 55, 57
BspFNI CGCG 1 cut(s) 57
BssECI CCNNGG 1 cut(s) 55
BstAPI GCANNNNNTGC 1 cut(s) 83
BstC8I GCNNGC 1 cut(s) 88
BstDSI CCRYGG 1 cut(s) 55
BstFNI CGCG 1 cut(s) 57
BstMWI GCNNNNNNNGC 1 cut(s) 83
BstUI CGCG 1 cut(s) 57
BstV1I GCAGC 1 cut(s) 33
BtgI CCRYGG 1 cut(s) 55
Cac8I GCNNGC 1 cut(s) 88
Cfr42I CCGCGG 1 cut(s) 58
CseI GACGC 1 cut(s) 83
FaiI YATR 2 cut(s) 10, 12
Fnu4HI GCNGC 1 cut(s) 47
Fsp4HI GCNGC 1 cut(s) 47
GluI GCNGC 1 cut(s) 47
HgaI GACGC 1 cut(s) 83
HinfI GANTC 1 cut(s) 104
HphI GGTGA 1 cut(s) 155
Hpy188I TCNGA 2 cut(s) 34, 109
HpyCH4V TGCA 1 cut(s) 49
HpyF10VI GCNNNNNNNGC 1 cut(s) 83
KspI CCGCGG 1 cut(s) 58
LpnPI CCDG 3 cut(s) 72, 126, 178
Lsp1109I GCAGC 1 cut(s) 33
LweI GCATC 2 cut(s) 33, 73
MaeIII GTNAC 3 cut(s) 3, 133, 151
MfeI CAATTG 1 cut(s) 78
MluCI AATT 1 cut(s) 78
MnlI CCTC 1 cut(s) 64
MspA1I CMGCKG 1 cut(s) 57
MunI CAATTG 1 cut(s) 78
MvnI CGCG 1 cut(s) 57
MwoI GCNNNNNNNGC 1 cut(s) 83
PcsI WCGNNNNNNNCGW 1 cut(s) 38
PfeI GAWTC 1 cut(s) 104
PkrI GCNGC 1 cut(s) 48
SacII CCGCGG 1 cut(s) 58
SatI GCNGC 1 cut(s) 47
SfaNI GCATC 2 cut(s) 33, 73
Sfr303I CCGCGG 1 cut(s) 58
SgeI CNNG 5 cut(s) 68, 76, 99, 153, 177
SgrBI CCGCGG 1 cut(s) 58
Sse9I AATT 1 cut(s) 78
SsiI CCGC 2 cut(s) 55, 57
SspI AATATT 1 cut(s) 29
TasI AATT 1 cut(s) 78
TfiI GAWTC 1 cut(s) 104
TseI GCWGC 1 cut(s) 46
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.