pycom14g13620

Tubulin is the major constituent of microtubules. It binds two moles of GTP, one at an exchangeable site on the beta chain and one at a non-exchangeable site on the alpha chain

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr14
N/A
Physical Location & Seq
Reverse (-)
16501838 .. 16502056
219 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 219 bp
ATGATTCGCAGAAAGTGTTATACCATCGATGGAAAACACATCTCTCGCTCCATCTTCGTCGATCTAGAGCCCATCGTCATCGACGAGGTTCGCTATCGTCATAGCACCATCATTGTCCATCTTCGATCTTTGTTATCCCTCAGGTCCCTCGGAGCATCCTTGATTGGGAGCCTGGTGTCATCGTCGACACCATCTTCGACTGCCGGAGACGGGAGATAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
Pfam Domains
Protein Families

Protein Analysis

73

Amino Acids

7.94

Weight (kDa)

10.0

Isoelectric Point (pI)

54.92

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 185
AfiI CCNNNNNNNGG 2 cut(s) 165, 210
AjnI CCWGG 1 cut(s) 171
Alw26I GTCTC 1 cut(s) 201
ArsI GACNNNNNNTTYG 2 cut(s) 178, 210
AspS9I GGNCC 1 cut(s) 144
AvaII GGWCC 1 cut(s) 144
AxyI CCTNAGG 1 cut(s) 140
BanII GRGCYC 1 cut(s) 72
BccI CCATC 7 cut(s) 23, 32, 59, 80, 116, 126, 199
BciT130I CCWGG 1 cut(s) 173
BcoDI GTCTC 1 cut(s) 201
BfaI CTAG 1 cut(s) 65
Bme1390I CCNGG 1 cut(s) 173
Bme18I GGWCC 1 cut(s) 144
BmgT120I GGNCC 1 cut(s) 144
BmiI GGNNCC 2 cut(s) 146, 170
BmrFI CCNGG 1 cut(s) 173
BmsI GCATC 1 cut(s) 164
Bsa29I ATCGAT 1 cut(s) 27
BsaJI CCNNGG 1 cut(s) 148
Bsc4I CCNNNNNNNGG 2 cut(s) 165, 210
Bse21I CCTNAGG 1 cut(s) 140
BseBI CCWGG 1 cut(s) 173
BseCI ATCGAT 1 cut(s) 27
BseDI CCNNGG 1 cut(s) 148
BseGI GGATG 1 cut(s) 155
BseLI CCNNNNNNNGG 2 cut(s) 165, 210
BseMII CTCAG 1 cut(s) 154
BshVI ATCGAT 1 cut(s) 27
BsiSI CCGG 1 cut(s) 204
BslFI GGGAC 1 cut(s) 130
BslI CCNNNNNNNGG 2 cut(s) 165, 210
BsmAI GTCTC 1 cut(s) 201
BsmBI CGTCTC 1 cut(s) 201
BsmFI GGGAC 1 cut(s) 130
Bsp1286I GDGCHC 1 cut(s) 72
Bsp143I GATC 2 cut(s) 61, 125
BspCNI CTCAG 1 cut(s) 153
BspDI ATCGAT 1 cut(s) 27
BspLI GGNNCC 2 cut(s) 146, 170
BssECI CCNNGG 1 cut(s) 148
BssMI GATC 2 cut(s) 61, 125
Bst2UI CCWGG 1 cut(s) 173
BstDEI CTNAG 1 cut(s) 140
BstF5I GGATG 1 cut(s) 155
BstKTI GATC 2 cut(s) 64, 128
BstMAI GTCTC 1 cut(s) 201
BstMBI GATC 2 cut(s) 61, 125
BstNI CCWGG 1 cut(s) 173
BstSCI CCNGG 1 cut(s) 171
Bsu15I ATCGAT 1 cut(s) 27
Bsu36I CCTNAGG 1 cut(s) 140
BsuTUI ATCGAT 1 cut(s) 27
BtsCI GGATG 1 cut(s) 155
Cfr13I GGNCC 1 cut(s) 144
ClaI ATCGAT 1 cut(s) 27
CviJI RGCY 2 cut(s) 70, 171
CviKI_1 RGCY 2 cut(s) 70, 171
DdeI CTNAG 1 cut(s) 140
DpnI GATC 2 cut(s) 63, 127
DpnII GATC 2 cut(s) 61, 125
Eco24I GRGCYC 1 cut(s) 72
Eco47I GGWCC 1 cut(s) 144
Eco81I CCTNAGG 1 cut(s) 140
EcoO109I RGGNCCY 1 cut(s) 144
EcoRII CCWGG 1 cut(s) 171
EcoT38I GRGCYC 1 cut(s) 72
Esp3I CGTCTC 1 cut(s) 201
FaiI YATR 2 cut(s) 21, 102
FaqI GGGAC 1 cut(s) 130
FblI GTMKAC 1 cut(s) 185
FokI GGATG 1 cut(s) 142
FriOI GRGCYC 1 cut(s) 72
FspBI CTAG 1 cut(s) 65
HapII CCGG 1 cut(s) 204
HincII GTYRAC 1 cut(s) 186
HindII GTYRAC 1 cut(s) 186
HinfI GANTC 1 cut(s) 4
HpaII CCGG 1 cut(s) 204
Hpy166II GTNNAC 1 cut(s) 186
Hpy188I TCNGA 1 cut(s) 152
Hpy188III TCNNGA 1 cut(s) 65
Hpy8I GTNNAC 1 cut(s) 186
Hpy99I CGWCG 3 cut(s) 62, 86, 187
HpyF3I CTNAG 1 cut(s) 140
Kzo9I GATC 2 cut(s) 61, 125
LmnI GCTCC 3 cut(s) 53, 152, 168
LpnPI CCDG 3 cut(s) 127, 158, 185
LweI GCATC 1 cut(s) 164
MaeI CTAG 1 cut(s) 65
MalI GATC 2 cut(s) 63, 127
MboI GATC 2 cut(s) 61, 125
MboII GAAGA 3 cut(s) 46, 113, 186
MhlI GDGCHC 1 cut(s) 72
MnlI CCTC 3 cut(s) 79, 149, 158
MspI CCGG 1 cut(s) 204
MspR9I CCNGG 1 cut(s) 173
MvaI CCWGG 1 cut(s) 173
NdeII GATC 2 cut(s) 61, 125
NlaIV GGNNCC 2 cut(s) 146, 170
PcsI WCGNNNNNNNCGW 1 cut(s) 81
PfeI GAWTC 1 cut(s) 4
PpuMI RGGWCCY 1 cut(s) 144
Psp5II RGGWCCY 1 cut(s) 144
Psp6I CCWGG 1 cut(s) 171
PspGI CCWGG 1 cut(s) 171
PspN4I GGNNCC 2 cut(s) 146, 170
PspPI GGNCC 1 cut(s) 144
PspPPI RGGWCCY 1 cut(s) 144
SalI GTCGAC 1 cut(s) 184
Sau3AI GATC 2 cut(s) 61, 125
Sau96I GGNCC 1 cut(s) 144
ScrFI CCNGG 1 cut(s) 173
SduI GDGCHC 1 cut(s) 72
SetI ASST 2 cut(s) 90, 146
SfaNI GCATC 1 cut(s) 164
SgeI CNNG 8 cut(s) 57, 77, 97, 154, 161, 172, 184, 185
SinI GGWCC 1 cut(s) 144
SspMI CTAG 1 cut(s) 65
StyD4I CCNGG 1 cut(s) 171
TaqI TCGA 6 cut(s) 27, 60, 81, 124, 185, 197
TfiI GAWTC 1 cut(s) 4
VpaK11BI GGWCC 1 cut(s) 144
XbaI TCTAGA 1 cut(s) 64
XmiI GTMKAC 1 cut(s) 185
XspI CTAG 1 cut(s) 65
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.