pycom14g15070
MYB Family

Transcription factor WER-like

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr14
N/A
Physical Location & Seq
Reverse (-)
17746143 .. 17746325
183 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 183 bp
ATGATGAACATCCAGGACCACAGTTTCTCTAAAAGTAAGGTTGGTTTTAGTGGCATGTGGGAGGCGACGATGGTGAGTAATGAAAAATTTTGGTTTCACAATGATGACCTTAATCTATATAGCCCTTATTTACGGGACCCTACTCTGGATGATCACTACCCTTTTCAATTTGATAATTTGTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

61

Amino Acids

7.21

Weight (kDa)

4.68

Isoelectric Point (pI)

44.93

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 86
AfiI CCNNNNNNNGG 1 cut(s) 145
AgsI TTSAA 1 cut(s) 167
AjnI CCWGG 1 cut(s) 12
ApoI RAATTY 1 cut(s) 86
AspS9I GGNCC 2 cut(s) 16, 136
AsuHPI GGTGA 1 cut(s) 85
AvaII GGWCC 2 cut(s) 16, 136
BccI CCATC 1 cut(s) 64
BciT130I CCWGG 1 cut(s) 14
BclI TGATCA 1 cut(s) 151
Bme1390I CCNGG 1 cut(s) 14
Bme18I GGWCC 2 cut(s) 16, 136
BmgT120I GGNCC 2 cut(s) 16, 136
BmiI GGNNCC 2 cut(s) 137, 138
BmrFI CCNGG 1 cut(s) 14
BsaBI GATNNNNATC 1 cut(s) 8
Bsc4I CCNNNNNNNGG 1 cut(s) 145
Bse8I GATNNNNATC 1 cut(s) 8
BseBI CCWGG 1 cut(s) 14
BseGI GGATG 2 cut(s) 9, 154
BseJI GATNNNNATC 1 cut(s) 8
BseLI CCNNNNNNNGG 1 cut(s) 145
BslFI GGGAC 1 cut(s) 149
BslI CCNNNNNNNGG 1 cut(s) 145
BsmFI GGGAC 1 cut(s) 149
Bsp143I GATC 1 cut(s) 151
BspLI GGNNCC 2 cut(s) 137, 138
BssMI GATC 1 cut(s) 151
Bst2UI CCWGG 1 cut(s) 14
Bst4CI ACNGT 1 cut(s) 23
BstF5I GGATG 2 cut(s) 9, 154
BstKTI GATC 1 cut(s) 154
BstMBI GATC 1 cut(s) 151
BstNI CCWGG 1 cut(s) 14
BstNSI RCATGY 1 cut(s) 58
BstSCI CCNGG 1 cut(s) 12
BtsCI GGATG 2 cut(s) 9, 154
Cfr13I GGNCC 2 cut(s) 16, 136
CviAII CATG 1 cut(s) 55
CviJI RGCY 1 cut(s) 123
CviKI_1 RGCY 1 cut(s) 123
DpnI GATC 1 cut(s) 153
DpnII GATC 1 cut(s) 151
Eco47I GGWCC 2 cut(s) 16, 136
EcoO109I RGGNCCY 1 cut(s) 136
EcoRII CCWGG 1 cut(s) 12
FaeI CATG 1 cut(s) 58
FaiI YATR 3 cut(s) 56, 118, 120
FaqI GGGAC 1 cut(s) 149
FatI CATG 1 cut(s) 54
FbaI TGATCA 1 cut(s) 151
FokI GGATG 1 cut(s) 161
Hin1II CATG 1 cut(s) 58
HphI GGTGA 1 cut(s) 85
Hpy188III TCNNGA 1 cut(s) 146
Hpy99I CGWCG 1 cut(s) 70
HpyCH4III ACNGT 1 cut(s) 23
Hsp92II CATG 1 cut(s) 58
KflI GGGWCCC 1 cut(s) 136
Ksp22I TGATCA 1 cut(s) 151
Kzo9I GATC 1 cut(s) 151
LpnPI CCDG 2 cut(s) 26, 131
MalI GATC 1 cut(s) 153
MboI GATC 1 cut(s) 151
MluCI AATT 3 cut(s) 86, 167, 175
MnlI CCTC 1 cut(s) 55
MseI TTAA 1 cut(s) 111
MslI CAYNNNNRTG 1 cut(s) 102
MspR9I CCNGG 1 cut(s) 14
MvaI CCWGG 1 cut(s) 14
NdeII GATC 1 cut(s) 151
NlaIII CATG 1 cut(s) 58
NlaIV GGNNCC 2 cut(s) 137, 138
NspI RCATGY 1 cut(s) 58
PfoI TCCNGGA 1 cut(s) 12
PpuMI RGGWCCY 1 cut(s) 136
Psp5II RGGWCCY 1 cut(s) 136
Psp6I CCWGG 1 cut(s) 12
PspGI CCWGG 1 cut(s) 12
PspN4I GGNNCC 2 cut(s) 137, 138
PspPI GGNCC 2 cut(s) 16, 136
PspPPI RGGWCCY 1 cut(s) 136
RseI CAYNNNNRTG 1 cut(s) 102
SaqAI TTAA 1 cut(s) 111
Sau3AI GATC 1 cut(s) 151
Sau96I GGNCC 2 cut(s) 16, 136
ScrFI CCNGG 1 cut(s) 14
SetI ASST 2 cut(s) 42, 111
SgeI CNNG 5 cut(s) 25, 26, 67, 146, 158
SinI GGWCC 2 cut(s) 16, 136
SmiMI CAYNNNNRTG 1 cut(s) 102
Sse9I AATT 3 cut(s) 86, 167, 175
StyD4I CCNGG 1 cut(s) 12
TaaI ACNGT 1 cut(s) 23
TasI AATT 3 cut(s) 86, 167, 175
Tru1I TTAA 1 cut(s) 111
Tru9I TTAA 1 cut(s) 111
TspDTI ATGAA 2 cut(s) 20, 96
VpaK11BI GGWCC 2 cut(s) 16, 136
XapI RAATTY 1 cut(s) 86
XceI RCATGY 1 cut(s) 58
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.