pycom14g17150

Cysteine-rich receptor-like protein kinase

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr14
N/A
Physical Location & Seq
Reverse (-)
19216165 .. 19216353
189 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 189 bp
ATGAATTTGTCAAATTTTCCCATCTCAACTTGTAGTGGTTATATGTCTTCCGAGTATGCAATGCACGGGCAATTTTCTGTCAAATCCAATCTGTATAATTTCGGTGTTTTAGTGCTAGAATTATCAGTGGCAAGAATAACAATAACTTCTTTCAGACTGATGCAGCTGAGAACCTTGCAAGCCATGTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

63

Amino Acids

7.0

Weight (kDa)

9.1

Isoelectric Point (pI)

43.97

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 2 cut(s) 4, 13
AluBI AGCT 1 cut(s) 166
AluI AGCT 1 cut(s) 166
ApeKI GCWGC 1 cut(s) 163
ApoI RAATTY 2 cut(s) 4, 13
BbsI GAAGAC 1 cut(s) 39
BbvI GCAGC 1 cut(s) 175
BccI CCATC 1 cut(s) 29
BfaI CTAG 1 cut(s) 116
BisI GCNGC 1 cut(s) 164
BlsI GCNGC 1 cut(s) 165
BmsI GCATC 1 cut(s) 150
BpiI GAAGAC 1 cut(s) 39
Bse3DI GCAATG 1 cut(s) 66
BseMI GCAATG 1 cut(s) 66
BseMII CTCAG 1 cut(s) 158
BseXI GCAGC 1 cut(s) 175
BspCNI CTCAG 1 cut(s) 159
BsrDI GCAATG 1 cut(s) 66
BstC8I GCNNGC 1 cut(s) 180
BstDEI CTNAG 1 cut(s) 167
BstV1I GCAGC 1 cut(s) 175
BstV2I GAAGAC 1 cut(s) 39
BtsIMutI CAGTG 1 cut(s) 132
Cac8I GCNNGC 1 cut(s) 180
CviAII CATG 1 cut(s) 184
CviJI RGCY 2 cut(s) 166, 182
CviKI_1 RGCY 2 cut(s) 166, 182
DdeI CTNAG 1 cut(s) 167
FaeI CATG 1 cut(s) 187
FaiI YATR 5 cut(s) 42, 44, 57, 96, 185
FatI CATG 1 cut(s) 183
Fnu4HI GCNGC 1 cut(s) 164
Fsp4HI GCNGC 1 cut(s) 164
FspBI CTAG 1 cut(s) 116
FspEI CC 9 cut(s) 21, 33, 34, 51, 52, 64, 87, 100, 113
GluI GCNGC 1 cut(s) 164
Hin1II CATG 1 cut(s) 187
Hpy188I TCNGA 2 cut(s) 52, 155
HpyCH4V TGCA 4 cut(s) 59, 64, 163, 178
HpyF3I CTNAG 1 cut(s) 167
Hsp92II CATG 1 cut(s) 187
Lsp1109I GCAGC 1 cut(s) 175
LweI GCATC 1 cut(s) 150
MaeI CTAG 1 cut(s) 116
MboII GAAGA 1 cut(s) 39
MluCI AATT 5 cut(s) 4, 13, 71, 97, 119
MspA1I CMGCKG 1 cut(s) 166
NlaIII CATG 1 cut(s) 187
PkrI GCNGC 1 cut(s) 165
PvuII CAGCTG 1 cut(s) 166
SatI GCNGC 1 cut(s) 164
SetI ASST 2 cut(s) 168, 176
SfaNI GCATC 1 cut(s) 150
SgeI CNNG 6 cut(s) 42, 64, 77, 79, 128, 144
Sse9I AATT 5 cut(s) 4, 13, 71, 97, 119
SspMI CTAG 1 cut(s) 116
TasI AATT 5 cut(s) 4, 13, 71, 97, 119
TscAI CASTG 1 cut(s) 132
TseI GCWGC 1 cut(s) 163
TspDTI ATGAA 1 cut(s) 17
TspRI CASTG 1 cut(s) 132
XapI RAATTY 2 cut(s) 4, 13
XspI CTAG 1 cut(s) 116
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.