pycom14g19880

Probably involved in the biogenesis of the COX complex

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr14
N/A
Physical Location & Seq
Reverse (-)
21073596 .. 21074044
449 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 351 bp
ATGGCAGCAAAAACCTCCATTGCCAAAACCATAACCAAGCTTTATTATTCGAGTGGGTCCCATTCCTCTCACCCCAAACATCTGGCCCCACTCTCACTATCTTCCTCCTTCTCCAGCTCCTCCCCTAATGCTGCTTCCCCAGCAGCCTTGTCCCAATCAACCATCTCTTCCCAAGCTCCAGGGAGGGAAAGGTCGAGATTGTCGAGATGGTTGCTGTTTCTTCCTGGAGCTGTCACTTTTGGGCTTGGGACTTGGCAGATTATCAGAAGGCAAGAGAAGGCGTTGCTTTCTTCCTGGAGCTACCATATCATCACACCTCTTGTCCCGGTCCCTGACAAAGATGAGAGGTAA
Functional Annotation
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

117

Amino Acids

12.59

Weight (kDa)

10.49

Isoelectric Point (pI)

74.72

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AjnI CCWGG 3 cut(s) 178, 223, 293
AluBI AGCT 5 cut(s) 40, 117, 176, 230, 300
AluI AGCT 5 cut(s) 40, 117, 176, 230, 300
AoxI GGCC 1 cut(s) 84
ApeKI GCWGC 3 cut(s) 5, 131, 143
AspS9I GGNCC 3 cut(s) 57, 85, 328
AsuC2I CCSGG 1 cut(s) 326
AsuHPI GGTGA 1 cut(s) 62
AvaII GGWCC 2 cut(s) 57, 328
BbvI GCAGC 3 cut(s) 17, 118, 155
BccI CCATC 2 cut(s) 170, 201
BcgI CGANNNNNNTGC 2 cut(s) 193, 227
BciT130I CCWGG 3 cut(s) 180, 225, 295
BcnI CCSGG 1 cut(s) 326
BisI GCNGC 3 cut(s) 6, 132, 144
BlsI GCNGC 3 cut(s) 7, 133, 145
Bme1390I CCNGG 4 cut(s) 180, 225, 295, 326
Bme18I GGWCC 2 cut(s) 57, 328
BmgT120I GGNCC 3 cut(s) 57, 85, 328
BmiI GGNNCC 4 cut(s) 58, 59, 87, 330
BmrFI CCNGG 4 cut(s) 180, 225, 295, 326
BpmI CTGGAG 4 cut(s) 97, 162, 246, 316
BpuMI CCSGG 1 cut(s) 326
BsaJI CCNNGG 1 cut(s) 179
Bse3DI GCAATG 1 cut(s) 18
BseBI CCWGG 3 cut(s) 180, 225, 295
BseDI CCNNGG 1 cut(s) 179
BseMI GCAATG 1 cut(s) 18
BseRI GAGGAG 1 cut(s) 109
BseXI GCAGC 3 cut(s) 17, 118, 155
BseYI CCCAGC 1 cut(s) 139
BshFI GGCC 1 cut(s) 86
BsiSI CCGG 1 cut(s) 326
BslFI GGGAC 5 cut(s) 43, 136, 262, 308, 314
BsmFI GGGAC 5 cut(s) 43, 136, 262, 308, 314
BsnI GGCC 1 cut(s) 86
BspANI GGCC 1 cut(s) 86
BspLI GGNNCC 4 cut(s) 58, 59, 87, 330
BsrDI GCAATG 1 cut(s) 18
BssECI CCNNGG 1 cut(s) 179
Bst2UI CCWGG 3 cut(s) 180, 225, 295
Bst6I CTCTTC 1 cut(s) 172
BstMWI GCNNNNNNNGC 1 cut(s) 140
BstNI CCWGG 3 cut(s) 180, 225, 295
BstSCI CCNGG 4 cut(s) 178, 223, 293, 324
BstV1I GCAGC 3 cut(s) 17, 118, 155
BstXI CCANNNNNNTGG 1 cut(s) 82
BsuRI GGCC 1 cut(s) 86
Cfr13I GGNCC 3 cut(s) 57, 85, 328
CviJI RGCY 8 cut(s) 40, 86, 117, 146, 176, 230, 244, 300
CviKI_1 RGCY 8 cut(s) 40, 86, 117, 146, 176, 230, 244, 300
Eam1104I CTCTTC 1 cut(s) 172
EarI CTCTTC 1 cut(s) 172
Eco47I GGWCC 2 cut(s) 57, 328
EcoO109I RGGNCCY 1 cut(s) 57
EcoRII CCWGG 3 cut(s) 178, 223, 293
FaiI YATR 2 cut(s) 32, 306
FaqI GGGAC 5 cut(s) 43, 136, 262, 308, 314
Fnu4HI GCNGC 3 cut(s) 6, 132, 144
Fsp4HI GCNGC 3 cut(s) 6, 132, 144
GluI GCNGC 3 cut(s) 6, 132, 144
GsaI CCCAGC 1 cut(s) 143
GsuI CTGGAG 4 cut(s) 97, 162, 246, 316
HaeIII GGCC 1 cut(s) 86
HapII CCGG 1 cut(s) 326
HindIII AAGCTT 1 cut(s) 38
HpaII CCGG 1 cut(s) 326
HphI GGTGA 1 cut(s) 62
Hpy188I TCNGA 1 cut(s) 266
Hpy188III TCNNGA 2 cut(s) 195, 204
HpyAV CCTTC 3 cut(s) 118, 261, 271
HpyF10VI GCNNNNNNNGC 1 cut(s) 140
KflI GGGWCCC 1 cut(s) 57
LmnI GCTCC 4 cut(s) 122, 181, 227, 297
Lsp1109I GCAGC 3 cut(s) 17, 118, 155
MaeIII GTNAC 1 cut(s) 232
MboII GAAGA 4 cut(s) 93, 159, 212, 282
MnlI CCTC 7 cut(s) 25, 76, 115, 130, 177, 327, 339
MspI CCGG 1 cut(s) 326
MspR9I CCNGG 4 cut(s) 180, 225, 295, 326
MvaI CCWGG 3 cut(s) 180, 225, 295
MwoI GCNNNNNNNGC 1 cut(s) 140
NciI CCSGG 1 cut(s) 326
NlaIV GGNNCC 4 cut(s) 58, 59, 87, 330
NmuCI GTSAC 1 cut(s) 232
PcsI WCGNNNNNNNCGW 1 cut(s) 200
PfoI TCCNGGA 2 cut(s) 223, 293
PkrI GCNGC 3 cut(s) 7, 133, 145
PpuMI RGGWCCY 1 cut(s) 57
Psp5II RGGWCCY 1 cut(s) 57
Psp6I CCWGG 3 cut(s) 178, 223, 293
PspFI CCCAGC 1 cut(s) 139
PspGI CCWGG 3 cut(s) 178, 223, 293
PspN4I GGNNCC 4 cut(s) 58, 59, 87, 330
PspPI GGNCC 3 cut(s) 57, 85, 328
PspPPI RGGWCCY 1 cut(s) 57
SatI GCNGC 3 cut(s) 6, 132, 144
Sau96I GGNCC 3 cut(s) 57, 85, 328
ScrFI CCNGG 4 cut(s) 180, 225, 295, 326
SetI ASST 9 cut(s) 17, 42, 119, 178, 194, 232, 302, 319, 350
SinI GGWCC 2 cut(s) 57, 328
StyD4I CCNGG 4 cut(s) 178, 223, 293, 324
TaqI TCGA 3 cut(s) 50, 194, 203
TseFI GTSAC 1 cut(s) 232
TseI GCWGC 3 cut(s) 5, 131, 143
Tsp45I GTSAC 1 cut(s) 232
VpaK11BI GGWCC 2 cut(s) 57, 328
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.