pycom15g00810

Prostaglandin E synthase

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr15
N/A
Physical Location & Seq
Reverse (-)
441909 .. 442469
561 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 246 bp
ATGAGCCAATCACAACAGAAAGTCGACGGCGAACAGATGGTTGATTCTTCAGGTCTTTGGACATTTTGTCACTTCCCTGTAGTGTGGGTGGATAAACGTTTAGTACATGTTTTATCTCTAAACTTATATCGAACTGTTTCAGAGGCTTTCGAGTCATTTGACTACATCACCAGTCATGGTATGGTATTGCACTACATCGTTACTGAATTATCTCTCTTTATTAACGTCCCATATCGTCAATTATAG

Protein Analysis

82

Amino Acids

9.47

Weight (kDa)

5.66

Isoelectric Point (pI)

50.75

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 24
AclI AACGTT 1 cut(s) 97
AcuI CTGAAG 1 cut(s) 33
AfaI GTAC 1 cut(s) 105
AflIII ACRYGT 1 cut(s) 106
AhdI GACNNNNNGTC 1 cut(s) 66
Asp700I GAANNNNTTC 1 cut(s) 136
AsuHPI GGTGA 1 cut(s) 160
BccI CCATC 1 cut(s) 31
BceAI ACGGC 1 cut(s) 43
BfmI CTRYAG 1 cut(s) 78
BmeRI GACNNNNNGTC 1 cut(s) 66
Bse1I ACTGG 1 cut(s) 171
BseNI ACTGG 1 cut(s) 171
BslFI GGGAC 1 cut(s) 212
BsmFI GGGAC 1 cut(s) 212
BsrI ACTGG 1 cut(s) 171
Bst4CI ACNGT 1 cut(s) 136
BstNSI RCATGY 1 cut(s) 110
BstSFI CTRYAG 1 cut(s) 78
Csp6I GTAC 1 cut(s) 104
CviAII CATG 2 cut(s) 107, 176
CviJI RGCY 2 cut(s) 6, 146
CviKI_1 RGCY 2 cut(s) 6, 146
CviQI GTAC 1 cut(s) 104
DriI GACNNNNNGTC 1 cut(s) 66
Eam1105I GACNNNNNGTC 1 cut(s) 66
Eco57I CTGAAG 1 cut(s) 33
FaeI CATG 2 cut(s) 110, 179
FaiI YATR 6 cut(s) 108, 127, 177, 182, 232, 244
FaqI GGGAC 1 cut(s) 212
FatI CATG 2 cut(s) 106, 175
FblI GTMKAC 1 cut(s) 24
Hin1II CATG 2 cut(s) 110, 179
HincII GTYRAC 1 cut(s) 25
HindII GTYRAC 1 cut(s) 25
HinfI GANTC 2 cut(s) 44, 152
HphI GGTGA 1 cut(s) 160
Hpy166II GTNNAC 1 cut(s) 25
Hpy188I TCNGA 1 cut(s) 142
Hpy8I GTNNAC 1 cut(s) 25
Hpy99I CGWCG 1 cut(s) 29
HpyCH4III ACNGT 1 cut(s) 136
HpyCH4IV ACGT 2 cut(s) 97, 225
HpyCH4V TGCA 1 cut(s) 190
HpySE526I ACGT 2 cut(s) 97, 225
Hsp92II CATG 2 cut(s) 110, 179
LpnPI CCDG 3 cut(s) 36, 90, 184
MaeII ACGT 2 cut(s) 97, 225
MaeIII GTNAC 2 cut(s) 68, 199
MboII GAAGA 1 cut(s) 39
MluCI AATT 2 cut(s) 206, 239
MlyI GAGTC 1 cut(s) 161
MnlI CCTC 1 cut(s) 136
MroXI GAANNNNTTC 1 cut(s) 136
MseI TTAA 1 cut(s) 222
NlaIII CATG 2 cut(s) 110, 179
NmuCI GTSAC 1 cut(s) 68
NspI RCATGY 1 cut(s) 110
PciI ACATGT 1 cut(s) 106
PdmI GAANNNNTTC 1 cut(s) 136
PfeI GAWTC 1 cut(s) 44
PleI GAGTC 1 cut(s) 160
PpsI GAGTC 1 cut(s) 160
PscI ACATGT 1 cut(s) 106
Psp1406I AACGTT 1 cut(s) 97
RsaI GTAC 1 cut(s) 105
RsaNI GTAC 1 cut(s) 104
SalI GTCGAC 1 cut(s) 23
SaqAI TTAA 1 cut(s) 222
SchI GAGTC 1 cut(s) 161
SetI ASST 3 cut(s) 55, 100, 228
SfcI CTRYAG 1 cut(s) 78
SgeI CNNG 6 cut(s) 63, 89, 119, 163, 183, 188
Sse9I AATT 2 cut(s) 206, 239
TaaI ACNGT 1 cut(s) 136
TaiI ACGT 2 cut(s) 100, 228
TaqI TCGA 3 cut(s) 24, 130, 150
TasI AATT 2 cut(s) 206, 239
TatI WGTACW 1 cut(s) 103
TfiI GAWTC 1 cut(s) 44
Tru1I TTAA 1 cut(s) 222
Tru9I TTAA 1 cut(s) 222
TseFI GTSAC 1 cut(s) 68
Tsp45I GTSAC 1 cut(s) 68
XceI RCATGY 1 cut(s) 110
XcmI CCANNNNNNNNNTGG 1 cut(s) 178
XmiI GTMKAC 1 cut(s) 24
XmnI GAANNNNTTC 1 cut(s) 136
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.