pycom15g07330

zinc finger

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr15
N/A
Physical Location & Seq
Forward (+)
4488614 .. 4488841
228 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 228 bp
ATGAACCATGAAGCTAAGCTCCTCTGCGGCCCAATCCACACCTTTCCCTATAAACCCTTCCCTCCAATTTCCCTCCATTCCTCCCACTCCCCCTTCTTCCATTCAAAACGCGCATTTCAACCCCAACCCATCACCACCACCGCCTTATTAAGTCATCCGCAAGCTCCGAAATCGACATGGTGCAAAACAAGCAGGGCATATACATGCCGAAGCGGAAGAAAGTCGTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

76

Amino Acids

8.48

Weight (kDa)

10.24

Isoelectric Point (pI)

53.37

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccII CGCG 1 cut(s) 111
AciI CCGC 4 cut(s) 27, 141, 158, 213
AgsI TTSAA 2 cut(s) 105, 119
AluBI AGCT 3 cut(s) 14, 19, 164
AluI AGCT 3 cut(s) 14, 19, 164
AoxI GGCC 1 cut(s) 28
AspLEI GCGC 1 cut(s) 113
AspS9I GGNCC 1 cut(s) 29
AsuHPI GGTGA 1 cut(s) 124
BccI CCATC 1 cut(s) 137
BisI GCNGC 1 cut(s) 28
BlpI GCTNAGC 1 cut(s) 15
BlsI GCNGC 1 cut(s) 29
BmgT120I GGNCC 1 cut(s) 29
Bpu1102I GCTNAGC 1 cut(s) 15
BseGI GGATG 1 cut(s) 154
BseRI GAGGAG 1 cut(s) 11
Bsh1236I CGCG 1 cut(s) 111
BshFI GGCC 1 cut(s) 30
BsnI GGCC 1 cut(s) 30
Bsp1720I GCTNAGC 1 cut(s) 15
BspACI CCGC 4 cut(s) 27, 141, 158, 213
BspANI GGCC 1 cut(s) 30
BspFNI CGCG 1 cut(s) 111
BstC8I GCNNGC 1 cut(s) 162
BstDEI CTNAG 1 cut(s) 15
BstF5I GGATG 1 cut(s) 154
BstFNI CGCG 1 cut(s) 111
BstHHI GCGC 1 cut(s) 113
BstMWI GCNNNNNNNGC 1 cut(s) 189
BstNSI RCATGY 1 cut(s) 207
BstUI CGCG 1 cut(s) 111
BsuRI GGCC 1 cut(s) 30
BtsCI GGATG 1 cut(s) 154
Cac8I GCNNGC 1 cut(s) 162
CfoI GCGC 1 cut(s) 113
Cfr13I GGNCC 1 cut(s) 29
CviAII CATG 3 cut(s) 8, 177, 204
CviJI RGCY 4 cut(s) 14, 19, 30, 164
CviKI_1 RGCY 4 cut(s) 14, 19, 30, 164
DdeI CTNAG 1 cut(s) 15
FaeI CATG 3 cut(s) 11, 180, 207
FaiI YATR 6 cut(s) 9, 51, 178, 199, 201, 205
FatI CATG 3 cut(s) 7, 176, 203
Fnu4HI GCNGC 1 cut(s) 28
FokI GGATG 1 cut(s) 141
Fsp4HI GCNGC 1 cut(s) 28
GlaI GCGC 1 cut(s) 112
GluI GCNGC 1 cut(s) 28
HaeIII GGCC 1 cut(s) 30
HhaI GCGC 1 cut(s) 113
Hin1II CATG 3 cut(s) 11, 180, 207
Hin6I GCGC 1 cut(s) 111
HinP1I GCGC 1 cut(s) 111
HphI GGTGA 1 cut(s) 124
Hpy188I TCNGA 1 cut(s) 168
Hpy188III TCNNGA 1 cut(s) 225
HpyAV CCTTC 2 cut(s) 67, 103
HpyCH4V TGCA 1 cut(s) 183
HpyF10VI GCNNNNNNNGC 1 cut(s) 189
HpyF3I CTNAG 1 cut(s) 15
Hsp92II CATG 3 cut(s) 11, 180, 207
HspAI GCGC 1 cut(s) 111
LmnI GCTCC 2 cut(s) 24, 169
LpnPI CCDG 1 cut(s) 178
MboII GAAGA 2 cut(s) 88, 228
MluCI AATT 1 cut(s) 66
MnlI CCTC 4 cut(s) 32, 72, 83, 91
MseI TTAA 1 cut(s) 149
MslI CAYNNNNRTG 1 cut(s) 202
MvnI CGCG 1 cut(s) 111
MwoI GCNNNNNNNGC 1 cut(s) 189
NlaIII CATG 3 cut(s) 11, 180, 207
NspI RCATGY 1 cut(s) 207
PkrI GCNGC 1 cut(s) 29
PspPI GGNCC 1 cut(s) 29
RseI CAYNNNNRTG 1 cut(s) 202
SaqAI TTAA 1 cut(s) 149
SatI GCNGC 1 cut(s) 28
Sau96I GGNCC 1 cut(s) 29
SetI ASST 4 cut(s) 16, 21, 44, 166
SgeI CNNG 7 cut(s) 20, 122, 173, 189, 201, 205, 216
SmiMI CAYNNNNRTG 1 cut(s) 202
Sse9I AATT 1 cut(s) 66
SsiI CCGC 4 cut(s) 27, 141, 158, 213
TaqI TCGA 1 cut(s) 173
TasI AATT 1 cut(s) 66
TauI GCSGC 1 cut(s) 30
Tru1I TTAA 1 cut(s) 149
Tru9I TTAA 1 cut(s) 149
TspDTI ATGAA 2 cut(s) 17, 24
XceI RCATGY 1 cut(s) 207
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.